ID: 1025670017

View in Genome Browser
Species Human (GRCh38)
Location 7:63609218-63609240
Sequence GCGTGCACACAGATTCAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025670017_1025670019 13 Left 1025670017 7:63609218-63609240 CCTATCTGAATCTGTGTGCACGC No data
Right 1025670019 7:63609254-63609276 AATGTGTCTGTGTGTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025670017 Original CRISPR GCGTGCACACAGATTCAGAT AGG (reversed) Intergenic
No off target data available for this crispr