ID: 1025671685

View in Genome Browser
Species Human (GRCh38)
Location 7:63619569-63619591
Sequence CTGTCAAAAGGGCTGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025671685_1025671690 2 Left 1025671685 7:63619569-63619591 CCTTCACCCAGCCCTTTTGACAG No data
Right 1025671690 7:63619594-63619616 TTCTTTCAACAACACTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025671685 Original CRISPR CTGTCAAAAGGGCTGGGTGA AGG (reversed) Intergenic
No off target data available for this crispr