ID: 1025677154

View in Genome Browser
Species Human (GRCh38)
Location 7:63652533-63652555
Sequence GAGGGGGCGCACGGGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025677149_1025677154 -10 Left 1025677149 7:63652520-63652542 CCAGCCCGCATTGGAGGGGGCGC No data
Right 1025677154 7:63652533-63652555 GAGGGGGCGCACGGGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025677154 Original CRISPR GAGGGGGCGCACGGGTGCAG TGG Intergenic