ID: 1025677154 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:63652533-63652555 |
| Sequence | GAGGGGGCGCACGGGTGCAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1025677149_1025677154 | -10 | Left | 1025677149 | 7:63652520-63652542 | CCAGCCCGCATTGGAGGGGGCGC | No data | ||
| Right | 1025677154 | 7:63652533-63652555 | GAGGGGGCGCACGGGTGCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1025677154 | Original CRISPR | GAGGGGGCGCACGGGTGCAG TGG | Intergenic | ||