ID: 1025679599

View in Genome Browser
Species Human (GRCh38)
Location 7:63671507-63671529
Sequence GTATAACTCCACAATGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025679590_1025679599 27 Left 1025679590 7:63671457-63671479 CCTGGCAGAAAGTCTCCAATGCT No data
Right 1025679599 7:63671507-63671529 GTATAACTCCACAATGGGAAGGG No data
1025679592_1025679599 12 Left 1025679592 7:63671472-63671494 CCAATGCTGATGCTGTGGCTTTC No data
Right 1025679599 7:63671507-63671529 GTATAACTCCACAATGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025679599 Original CRISPR GTATAACTCCACAATGGGAA GGG Intergenic
No off target data available for this crispr