ID: 1025679918

View in Genome Browser
Species Human (GRCh38)
Location 7:63673844-63673866
Sequence CTGGGGCCATGGATGGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025679909_1025679918 25 Left 1025679909 7:63673796-63673818 CCATTTCTAGGAGACACTTAAGG No data
Right 1025679918 7:63673844-63673866 CTGGGGCCATGGATGGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025679918 Original CRISPR CTGGGGCCATGGATGGTGCT AGG Intergenic
No off target data available for this crispr