ID: 1025680948

View in Genome Browser
Species Human (GRCh38)
Location 7:63681158-63681180
Sequence TACCCAAGGATGCTCGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025680943_1025680948 3 Left 1025680943 7:63681132-63681154 CCTGGGTTAACTAGGGCTATTGG No data
Right 1025680948 7:63681158-63681180 TACCCAAGGATGCTCGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025680948 Original CRISPR TACCCAAGGATGCTCGTGGC AGG Intergenic
No off target data available for this crispr