ID: 1025695463

View in Genome Browser
Species Human (GRCh38)
Location 7:63772229-63772251
Sequence CCTCAATGAGGGCCCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025695463_1025695468 -8 Left 1025695463 7:63772229-63772251 CCCTGGAGGGGCCCTCATTGAGG No data
Right 1025695468 7:63772244-63772266 CATTGAGGACGCGTTGCACCTGG No data
1025695463_1025695474 18 Left 1025695463 7:63772229-63772251 CCCTGGAGGGGCCCTCATTGAGG No data
Right 1025695474 7:63772270-63772292 GGCCACCGGGAAGCCGGAGCTGG No data
1025695463_1025695479 29 Left 1025695463 7:63772229-63772251 CCCTGGAGGGGCCCTCATTGAGG No data
Right 1025695479 7:63772281-63772303 AGCCGGAGCTGGGCCTGGAGAGG No data
1025695463_1025695470 4 Left 1025695463 7:63772229-63772251 CCCTGGAGGGGCCCTCATTGAGG No data
Right 1025695470 7:63772256-63772278 GTTGCACCTGGAGAGGCCACCGG No data
1025695463_1025695475 19 Left 1025695463 7:63772229-63772251 CCCTGGAGGGGCCCTCATTGAGG No data
Right 1025695475 7:63772271-63772293 GCCACCGGGAAGCCGGAGCTGGG No data
1025695463_1025695469 -3 Left 1025695463 7:63772229-63772251 CCCTGGAGGGGCCCTCATTGAGG No data
Right 1025695469 7:63772249-63772271 AGGACGCGTTGCACCTGGAGAGG No data
1025695463_1025695473 12 Left 1025695463 7:63772229-63772251 CCCTGGAGGGGCCCTCATTGAGG No data
Right 1025695473 7:63772264-63772286 TGGAGAGGCCACCGGGAAGCCGG No data
1025695463_1025695478 24 Left 1025695463 7:63772229-63772251 CCCTGGAGGGGCCCTCATTGAGG No data
Right 1025695478 7:63772276-63772298 CGGGAAGCCGGAGCTGGGCCTGG No data
1025695463_1025695471 5 Left 1025695463 7:63772229-63772251 CCCTGGAGGGGCCCTCATTGAGG No data
Right 1025695471 7:63772257-63772279 TTGCACCTGGAGAGGCCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025695463 Original CRISPR CCTCAATGAGGGCCCCTCCA GGG (reversed) Intergenic
No off target data available for this crispr