ID: 1025695470

View in Genome Browser
Species Human (GRCh38)
Location 7:63772256-63772278
Sequence GTTGCACCTGGAGAGGCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025695463_1025695470 4 Left 1025695463 7:63772229-63772251 CCCTGGAGGGGCCCTCATTGAGG No data
Right 1025695470 7:63772256-63772278 GTTGCACCTGGAGAGGCCACCGG No data
1025695466_1025695470 -7 Left 1025695466 7:63772240-63772262 CCCTCATTGAGGACGCGTTGCAC No data
Right 1025695470 7:63772256-63772278 GTTGCACCTGGAGAGGCCACCGG No data
1025695467_1025695470 -8 Left 1025695467 7:63772241-63772263 CCTCATTGAGGACGCGTTGCACC No data
Right 1025695470 7:63772256-63772278 GTTGCACCTGGAGAGGCCACCGG No data
1025695465_1025695470 3 Left 1025695465 7:63772230-63772252 CCTGGAGGGGCCCTCATTGAGGA No data
Right 1025695470 7:63772256-63772278 GTTGCACCTGGAGAGGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025695470 Original CRISPR GTTGCACCTGGAGAGGCCAC CGG Intergenic
No off target data available for this crispr