ID: 1025695471

View in Genome Browser
Species Human (GRCh38)
Location 7:63772257-63772279
Sequence TTGCACCTGGAGAGGCCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025695466_1025695471 -6 Left 1025695466 7:63772240-63772262 CCCTCATTGAGGACGCGTTGCAC No data
Right 1025695471 7:63772257-63772279 TTGCACCTGGAGAGGCCACCGGG No data
1025695463_1025695471 5 Left 1025695463 7:63772229-63772251 CCCTGGAGGGGCCCTCATTGAGG No data
Right 1025695471 7:63772257-63772279 TTGCACCTGGAGAGGCCACCGGG No data
1025695465_1025695471 4 Left 1025695465 7:63772230-63772252 CCTGGAGGGGCCCTCATTGAGGA No data
Right 1025695471 7:63772257-63772279 TTGCACCTGGAGAGGCCACCGGG No data
1025695467_1025695471 -7 Left 1025695467 7:63772241-63772263 CCTCATTGAGGACGCGTTGCACC No data
Right 1025695471 7:63772257-63772279 TTGCACCTGGAGAGGCCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025695471 Original CRISPR TTGCACCTGGAGAGGCCACC GGG Intergenic
No off target data available for this crispr