ID: 1025695481

View in Genome Browser
Species Human (GRCh38)
Location 7:63772292-63772314
Sequence GGCCTGGAGAGGCCGACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025695466_1025695481 29 Left 1025695466 7:63772240-63772262 CCCTCATTGAGGACGCGTTGCAC No data
Right 1025695481 7:63772292-63772314 GGCCTGGAGAGGCCGACTTCAGG No data
1025695477_1025695481 -6 Left 1025695477 7:63772275-63772297 CCGGGAAGCCGGAGCTGGGCCTG No data
Right 1025695481 7:63772292-63772314 GGCCTGGAGAGGCCGACTTCAGG No data
1025695467_1025695481 28 Left 1025695467 7:63772241-63772263 CCTCATTGAGGACGCGTTGCACC No data
Right 1025695481 7:63772292-63772314 GGCCTGGAGAGGCCGACTTCAGG No data
1025695476_1025695481 -3 Left 1025695476 7:63772272-63772294 CCACCGGGAAGCCGGAGCTGGGC No data
Right 1025695481 7:63772292-63772314 GGCCTGGAGAGGCCGACTTCAGG No data
1025695472_1025695481 7 Left 1025695472 7:63772262-63772284 CCTGGAGAGGCCACCGGGAAGCC No data
Right 1025695481 7:63772292-63772314 GGCCTGGAGAGGCCGACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025695481 Original CRISPR GGCCTGGAGAGGCCGACTTC AGG Intergenic
No off target data available for this crispr