ID: 1025698644

View in Genome Browser
Species Human (GRCh38)
Location 7:63795688-63795710
Sequence TGAAAATCAAGTCCACGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025698640_1025698644 4 Left 1025698640 7:63795661-63795683 CCGTGTTGTTCAAGGGTCCACTG 0: 6
1: 237
2: 608
3: 847
4: 946
Right 1025698644 7:63795688-63795710 TGAAAATCAAGTCCACGGTCGGG No data
1025698636_1025698644 19 Left 1025698636 7:63795646-63795668 CCACGCAGCTTAAACCCGTGTTG No data
Right 1025698644 7:63795688-63795710 TGAAAATCAAGTCCACGGTCGGG No data
1025698635_1025698644 20 Left 1025698635 7:63795645-63795667 CCCACGCAGCTTAAACCCGTGTT No data
Right 1025698644 7:63795688-63795710 TGAAAATCAAGTCCACGGTCGGG No data
1025698639_1025698644 5 Left 1025698639 7:63795660-63795682 CCCGTGTTGTTCAAGGGTCCACT 0: 9
1: 186
2: 645
3: 1115
4: 1265
Right 1025698644 7:63795688-63795710 TGAAAATCAAGTCCACGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025698644 Original CRISPR TGAAAATCAAGTCCACGGTC GGG Intergenic
No off target data available for this crispr