ID: 1025703528

View in Genome Browser
Species Human (GRCh38)
Location 7:63842174-63842196
Sequence GTGTATACACACATATATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025703528_1025703529 29 Left 1025703528 7:63842174-63842196 CCAAAATATATGTGTGTATACAC No data
Right 1025703529 7:63842226-63842248 CACACATATATGTAAAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025703528 Original CRISPR GTGTATACACACATATATTT TGG (reversed) Intergenic
No off target data available for this crispr