ID: 1025709784

View in Genome Browser
Species Human (GRCh38)
Location 7:63898699-63898721
Sequence TGTTGGGTATAAAACTTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025709784_1025709793 22 Left 1025709784 7:63898699-63898721 CCGCCCAAGTTTTATACCCAACA No data
Right 1025709793 7:63898744-63898766 ATACAAATAAAACCCTACCAAGG 0: 1
1: 3
2: 17
3: 53
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025709784 Original CRISPR TGTTGGGTATAAAACTTGGG CGG (reversed) Intergenic
No off target data available for this crispr