ID: 1025713178

View in Genome Browser
Species Human (GRCh38)
Location 7:63930524-63930546
Sequence CAGACTTAGCACTGTGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025713178_1025713186 30 Left 1025713178 7:63930524-63930546 CCCAGTTCACAGTGCTAAGTCTG No data
Right 1025713186 7:63930577-63930599 ACTCCCTCACCGCTGCTACCAGG No data
1025713178_1025713181 -3 Left 1025713178 7:63930524-63930546 CCCAGTTCACAGTGCTAAGTCTG No data
Right 1025713181 7:63930544-63930566 CTGAGGCTTCCTCAGAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025713178 Original CRISPR CAGACTTAGCACTGTGAACT GGG (reversed) Intergenic
No off target data available for this crispr