ID: 1025715697

View in Genome Browser
Species Human (GRCh38)
Location 7:63953465-63953487
Sequence GCCAGAGCAGACAATGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025715697_1025715699 -3 Left 1025715697 7:63953465-63953487 CCACCTTCATTGTCTGCTCTGGC No data
Right 1025715699 7:63953485-63953507 GGCCAAGAGCATGTCTCCCCAGG No data
1025715697_1025715703 7 Left 1025715697 7:63953465-63953487 CCACCTTCATTGTCTGCTCTGGC No data
Right 1025715703 7:63953495-63953517 ATGTCTCCCCAGGAGAGCTGGGG No data
1025715697_1025715709 30 Left 1025715697 7:63953465-63953487 CCACCTTCATTGTCTGCTCTGGC No data
Right 1025715709 7:63953518-63953540 GCCCAGGATCACTGAAGCCCAGG No data
1025715697_1025715707 14 Left 1025715697 7:63953465-63953487 CCACCTTCATTGTCTGCTCTGGC No data
Right 1025715707 7:63953502-63953524 CCCAGGAGAGCTGGGGGCCCAGG No data
1025715697_1025715702 6 Left 1025715697 7:63953465-63953487 CCACCTTCATTGTCTGCTCTGGC No data
Right 1025715702 7:63953494-63953516 CATGTCTCCCCAGGAGAGCTGGG No data
1025715697_1025715704 8 Left 1025715697 7:63953465-63953487 CCACCTTCATTGTCTGCTCTGGC No data
Right 1025715704 7:63953496-63953518 TGTCTCCCCAGGAGAGCTGGGGG No data
1025715697_1025715701 5 Left 1025715697 7:63953465-63953487 CCACCTTCATTGTCTGCTCTGGC No data
Right 1025715701 7:63953493-63953515 GCATGTCTCCCCAGGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025715697 Original CRISPR GCCAGAGCAGACAATGAAGG TGG (reversed) Intergenic
No off target data available for this crispr