ID: 1025715699

View in Genome Browser
Species Human (GRCh38)
Location 7:63953485-63953507
Sequence GGCCAAGAGCATGTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025715694_1025715699 25 Left 1025715694 7:63953437-63953459 CCTGACAGCTCAGCATGTCTTCT No data
Right 1025715699 7:63953485-63953507 GGCCAAGAGCATGTCTCCCCAGG No data
1025715698_1025715699 -6 Left 1025715698 7:63953468-63953490 CCTTCATTGTCTGCTCTGGCCAA No data
Right 1025715699 7:63953485-63953507 GGCCAAGAGCATGTCTCCCCAGG No data
1025715692_1025715699 29 Left 1025715692 7:63953433-63953455 CCCACCTGACAGCTCAGCATGTC No data
Right 1025715699 7:63953485-63953507 GGCCAAGAGCATGTCTCCCCAGG No data
1025715697_1025715699 -3 Left 1025715697 7:63953465-63953487 CCACCTTCATTGTCTGCTCTGGC No data
Right 1025715699 7:63953485-63953507 GGCCAAGAGCATGTCTCCCCAGG No data
1025715693_1025715699 28 Left 1025715693 7:63953434-63953456 CCACCTGACAGCTCAGCATGTCT No data
Right 1025715699 7:63953485-63953507 GGCCAAGAGCATGTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025715699 Original CRISPR GGCCAAGAGCATGTCTCCCC AGG Intergenic
No off target data available for this crispr