ID: 1025715700

View in Genome Browser
Species Human (GRCh38)
Location 7:63953487-63953509
Sequence CTCCTGGGGAGACATGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025715700_1025715707 -8 Left 1025715700 7:63953487-63953509 CCAAGAGCATGTCTCCCCAGGAG No data
Right 1025715707 7:63953502-63953524 CCCAGGAGAGCTGGGGGCCCAGG No data
1025715700_1025715713 12 Left 1025715700 7:63953487-63953509 CCAAGAGCATGTCTCCCCAGGAG No data
Right 1025715713 7:63953522-63953544 AGGATCACTGAAGCCCAGGTGGG No data
1025715700_1025715712 11 Left 1025715700 7:63953487-63953509 CCAAGAGCATGTCTCCCCAGGAG No data
Right 1025715712 7:63953521-63953543 CAGGATCACTGAAGCCCAGGTGG No data
1025715700_1025715709 8 Left 1025715700 7:63953487-63953509 CCAAGAGCATGTCTCCCCAGGAG No data
Right 1025715709 7:63953518-63953540 GCCCAGGATCACTGAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025715700 Original CRISPR CTCCTGGGGAGACATGCTCT TGG (reversed) Intergenic
No off target data available for this crispr