ID: 1025715704

View in Genome Browser
Species Human (GRCh38)
Location 7:63953496-63953518
Sequence TGTCTCCCCAGGAGAGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025715698_1025715704 5 Left 1025715698 7:63953468-63953490 CCTTCATTGTCTGCTCTGGCCAA No data
Right 1025715704 7:63953496-63953518 TGTCTCCCCAGGAGAGCTGGGGG No data
1025715697_1025715704 8 Left 1025715697 7:63953465-63953487 CCACCTTCATTGTCTGCTCTGGC No data
Right 1025715704 7:63953496-63953518 TGTCTCCCCAGGAGAGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025715704 Original CRISPR TGTCTCCCCAGGAGAGCTGG GGG Intergenic
No off target data available for this crispr