ID: 1025715707

View in Genome Browser
Species Human (GRCh38)
Location 7:63953502-63953524
Sequence CCCAGGAGAGCTGGGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025715697_1025715707 14 Left 1025715697 7:63953465-63953487 CCACCTTCATTGTCTGCTCTGGC No data
Right 1025715707 7:63953502-63953524 CCCAGGAGAGCTGGGGGCCCAGG No data
1025715700_1025715707 -8 Left 1025715700 7:63953487-63953509 CCAAGAGCATGTCTCCCCAGGAG No data
Right 1025715707 7:63953502-63953524 CCCAGGAGAGCTGGGGGCCCAGG No data
1025715698_1025715707 11 Left 1025715698 7:63953468-63953490 CCTTCATTGTCTGCTCTGGCCAA No data
Right 1025715707 7:63953502-63953524 CCCAGGAGAGCTGGGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025715707 Original CRISPR CCCAGGAGAGCTGGGGGCCC AGG Intergenic
No off target data available for this crispr