ID: 1025715709

View in Genome Browser
Species Human (GRCh38)
Location 7:63953518-63953540
Sequence GCCCAGGATCACTGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025715706_1025715709 -7 Left 1025715706 7:63953502-63953524 CCCAGGAGAGCTGGGGGCCCAGG No data
Right 1025715709 7:63953518-63953540 GCCCAGGATCACTGAAGCCCAGG No data
1025715698_1025715709 27 Left 1025715698 7:63953468-63953490 CCTTCATTGTCTGCTCTGGCCAA No data
Right 1025715709 7:63953518-63953540 GCCCAGGATCACTGAAGCCCAGG No data
1025715697_1025715709 30 Left 1025715697 7:63953465-63953487 CCACCTTCATTGTCTGCTCTGGC No data
Right 1025715709 7:63953518-63953540 GCCCAGGATCACTGAAGCCCAGG No data
1025715705_1025715709 -6 Left 1025715705 7:63953501-63953523 CCCCAGGAGAGCTGGGGGCCCAG No data
Right 1025715709 7:63953518-63953540 GCCCAGGATCACTGAAGCCCAGG No data
1025715708_1025715709 -8 Left 1025715708 7:63953503-63953525 CCAGGAGAGCTGGGGGCCCAGGA No data
Right 1025715709 7:63953518-63953540 GCCCAGGATCACTGAAGCCCAGG No data
1025715700_1025715709 8 Left 1025715700 7:63953487-63953509 CCAAGAGCATGTCTCCCCAGGAG No data
Right 1025715709 7:63953518-63953540 GCCCAGGATCACTGAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025715709 Original CRISPR GCCCAGGATCACTGAAGCCC AGG Intergenic
No off target data available for this crispr