ID: 1025717979

View in Genome Browser
Species Human (GRCh38)
Location 7:63981452-63981474
Sequence AGTGTTGCCATTCAGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025717979_1025717985 15 Left 1025717979 7:63981452-63981474 CCACATCCCTGAATGGCAACACT No data
Right 1025717985 7:63981490-63981512 CATATTTAGCAAATGGTCATAGG No data
1025717979_1025717984 8 Left 1025717979 7:63981452-63981474 CCACATCCCTGAATGGCAACACT No data
Right 1025717984 7:63981483-63981505 AACAAAACATATTTAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025717979 Original CRISPR AGTGTTGCCATTCAGGGATG TGG (reversed) Intergenic
No off target data available for this crispr