ID: 1025717980

View in Genome Browser
Species Human (GRCh38)
Location 7:63981458-63981480
Sequence TCAGGGAGTGTTGCCATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025717980_1025717985 9 Left 1025717980 7:63981458-63981480 CCCTGAATGGCAACACTCCCTGA No data
Right 1025717985 7:63981490-63981512 CATATTTAGCAAATGGTCATAGG No data
1025717980_1025717984 2 Left 1025717980 7:63981458-63981480 CCCTGAATGGCAACACTCCCTGA No data
Right 1025717984 7:63981483-63981505 AACAAAACATATTTAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025717980 Original CRISPR TCAGGGAGTGTTGCCATTCA GGG (reversed) Intergenic
No off target data available for this crispr