ID: 1025717983

View in Genome Browser
Species Human (GRCh38)
Location 7:63981476-63981498
Sequence CTAAATATGTTTTGTTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025717983_1025717986 15 Left 1025717983 7:63981476-63981498 CCTGAAAAACAAAACATATTTAG No data
Right 1025717986 7:63981514-63981536 AGAATTCTCAATTTTACATTAGG No data
1025717983_1025717985 -9 Left 1025717983 7:63981476-63981498 CCTGAAAAACAAAACATATTTAG No data
Right 1025717985 7:63981490-63981512 CATATTTAGCAAATGGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025717983 Original CRISPR CTAAATATGTTTTGTTTTTC AGG (reversed) Intergenic
No off target data available for this crispr