ID: 1025717985

View in Genome Browser
Species Human (GRCh38)
Location 7:63981490-63981512
Sequence CATATTTAGCAAATGGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025717979_1025717985 15 Left 1025717979 7:63981452-63981474 CCACATCCCTGAATGGCAACACT No data
Right 1025717985 7:63981490-63981512 CATATTTAGCAAATGGTCATAGG No data
1025717980_1025717985 9 Left 1025717980 7:63981458-63981480 CCCTGAATGGCAACACTCCCTGA No data
Right 1025717985 7:63981490-63981512 CATATTTAGCAAATGGTCATAGG No data
1025717981_1025717985 8 Left 1025717981 7:63981459-63981481 CCTGAATGGCAACACTCCCTGAA No data
Right 1025717985 7:63981490-63981512 CATATTTAGCAAATGGTCATAGG No data
1025717983_1025717985 -9 Left 1025717983 7:63981476-63981498 CCTGAAAAACAAAACATATTTAG No data
Right 1025717985 7:63981490-63981512 CATATTTAGCAAATGGTCATAGG No data
1025717982_1025717985 -8 Left 1025717982 7:63981475-63981497 CCCTGAAAAACAAAACATATTTA No data
Right 1025717985 7:63981490-63981512 CATATTTAGCAAATGGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025717985 Original CRISPR CATATTTAGCAAATGGTCAT AGG Intergenic
No off target data available for this crispr