ID: 1025724946

View in Genome Browser
Species Human (GRCh38)
Location 7:64047810-64047832
Sequence GTGCTGGTATTGAGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 2, 2: 2, 3: 21, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025724938_1025724946 21 Left 1025724938 7:64047766-64047788 CCTAGCTTTCCTTTCTGCAGACA 0: 1
1: 0
2: 6
3: 29
4: 326
Right 1025724946 7:64047810-64047832 GTGCTGGTATTGAGGGAAAAAGG 0: 1
1: 2
2: 2
3: 21
4: 239
1025724940_1025724946 12 Left 1025724940 7:64047775-64047797 CCTTTCTGCAGACACATTGGTGC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1025724946 7:64047810-64047832 GTGCTGGTATTGAGGGAAAAAGG 0: 1
1: 2
2: 2
3: 21
4: 239
1025724937_1025724946 22 Left 1025724937 7:64047765-64047787 CCCTAGCTTTCCTTTCTGCAGAC 0: 1
1: 0
2: 4
3: 45
4: 491
Right 1025724946 7:64047810-64047832 GTGCTGGTATTGAGGGAAAAAGG 0: 1
1: 2
2: 2
3: 21
4: 239
1025724936_1025724946 30 Left 1025724936 7:64047757-64047779 CCTCTCAACCCTAGCTTTCCTTT 0: 1
1: 0
2: 1
3: 22
4: 252
Right 1025724946 7:64047810-64047832 GTGCTGGTATTGAGGGAAAAAGG 0: 1
1: 2
2: 2
3: 21
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025724946 Original CRISPR GTGCTGGTATTGAGGGAAAA AGG Intronic
900767441 1:4514592-4514614 GTGCAGGTAGAGAGGGAACAGGG - Intergenic
903387158 1:22934804-22934826 TTGCTGGTTTTGAAGGAAGAAGG - Intergenic
903829282 1:26164913-26164935 GTTCTGAGATTGAGGGAAAGGGG + Intergenic
904480217 1:30788621-30788643 GTGCTGGCATTGAACAAAAAAGG - Intergenic
904855223 1:33492820-33492842 GTACAGGTATTGAGTGAATATGG + Intronic
906064341 1:42969400-42969422 GTGCTGGGATTATGGGAAAAAGG + Intergenic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918446313 1:184620616-184620638 GTGCTGGAAGTAAGAGAAAAAGG - Exonic
918713989 1:187766034-187766056 GGGGTGGTATGGAGAGAAAATGG + Intergenic
918865760 1:189897268-189897290 CTGCTGGTAATAATGGAAAATGG + Intergenic
921049735 1:211502459-211502481 GTCCTGGTTTTGGGGGATAATGG - Intergenic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
1064308923 10:14194287-14194309 ATGCTGGCATTGTGGGGAAAGGG + Intronic
1065233282 10:23621090-23621112 GTGCATGTAGGGAGGGAAAAAGG + Intergenic
1065278961 10:24115458-24115480 GGGCTGGCATTGGGGTAAAAAGG + Intronic
1067210433 10:44256400-44256422 GTGTTGGCCTTGAGGGAGAACGG + Intergenic
1067332767 10:45337404-45337426 GAGCTGAAATTGTGGGAAAATGG + Intergenic
1068057935 10:52034282-52034304 GTGGTGGTATGGAGAGAGAATGG + Intronic
1068361426 10:55978427-55978449 GGGGTGGTATTGAGAGATAATGG - Intergenic
1068764358 10:60746628-60746650 GGGCTGGAGGTGAGGGAAAACGG - Intergenic
1070326370 10:75392048-75392070 TTGCTGGTAATGAGGAAAAGAGG + Intergenic
1072987742 10:100156438-100156460 GTGCTAGTTTTGTGGGAAGAAGG + Intronic
1073628355 10:105122132-105122154 GTGCTGATAATGAGGGAAGTTGG + Intronic
1076511189 10:131014661-131014683 GTGTTGGCAATGAGGGAAAGGGG + Intergenic
1077790719 11:5437031-5437053 GTGCTGGTATTGGGGAAAGGAGG + Intronic
1079322550 11:19463715-19463737 GAGCTGGTGATGAGGGAGAAGGG + Intronic
1081347749 11:42011131-42011153 GTTCTTTTATTGAGGAAAAAAGG - Intergenic
1083173235 11:60934989-60935011 GACCGGGTCTTGAGGGAAAAGGG + Intronic
1083482547 11:62959111-62959133 GTGCAGGTGGTGAGGGCAAAGGG - Intronic
1083645165 11:64167902-64167924 GTACTGGGAGTGAGGGCAAAGGG + Intergenic
1084337991 11:68472514-68472536 GTGCTGGTAGTGAGGTAAAGAGG - Intronic
1085934698 11:81126981-81127003 GGGGTGGTATGGAGAGAAAATGG - Intergenic
1086129598 11:83387070-83387092 GTGGGGGTAATGAGGGAAACTGG - Intergenic
1086289320 11:85289271-85289293 GTGCTGGTGGTGAGGAAAGAGGG - Intronic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1092683092 12:11010375-11010397 GTGCTGGAATTCAGGGCAATGGG + Intronic
1094067833 12:26380108-26380130 GTGCTGGAAGTGAGGATAAAAGG - Intronic
1095277153 12:40299832-40299854 GTGGTGGTGGTGAGGGAAGAAGG + Intronic
1095852983 12:46831132-46831154 GTGCCGGTTGTGGGGGAAAACGG - Intronic
1095888552 12:47214420-47214442 GTGCTGTAAGGGAGGGAAAATGG + Intronic
1095971839 12:47907182-47907204 GTTCAGGTATTGGGGGAATATGG - Intronic
1097944801 12:65355057-65355079 GTGCTAGAAATGAGGGAAAGAGG + Intronic
1099241179 12:80141182-80141204 GTGGTGGTTTCAAGGGAAAAAGG + Intergenic
1099382768 12:81975683-81975705 GTGGTGGTATGGAGAGAGAATGG + Intergenic
1100913774 12:99394451-99394473 GTGGTGGTTTTAAGGGAGAAAGG - Intronic
1101482473 12:105112519-105112541 GTGCTGGTAGTAATGTAAAATGG - Intronic
1103835518 12:123816884-123816906 GTGCTGGTATGGATGTAAAGGGG - Intronic
1104677775 12:130726081-130726103 GTGGTGAGATTGAGAGAAAAGGG + Intergenic
1104687862 12:130800826-130800848 GTGCTAGAATTAAGAGAAAAGGG - Intronic
1106396408 13:29385188-29385210 GTGCTGGTATTGTGGTAGCACGG - Intronic
1107538948 13:41367089-41367111 ATGCTGGTTTTTAGGGAATATGG + Intronic
1108947880 13:56045728-56045750 GTGGTGGTATGGAGAGAGAATGG - Intergenic
1109221230 13:59642979-59643001 GCTTTGGTATTGAGGGGAAATGG + Intergenic
1109490021 13:63085487-63085509 GTGTTGGTAGCAAGGGAAAATGG + Intergenic
1109714962 13:66209464-66209486 TTGTTAGTACTGAGGGAAAATGG - Intergenic
1110978962 13:81871954-81871976 GGGATGGTATTGAGAGATAATGG - Intergenic
1112010024 13:95286026-95286048 GTGGTGCTATTAACGGAAAAAGG + Intronic
1113990222 14:16022893-16022915 GTGTGGGTATTGTGAGAAAAAGG + Intergenic
1114181329 14:20370334-20370356 GGTCTGGTATTGATGGGAAAGGG - Intronic
1115701721 14:35959998-35960020 GTGTTGGCAATGAGTGAAAATGG + Intergenic
1116349451 14:43841652-43841674 GGGCTGGGATTATGGGAAAATGG - Intergenic
1116520711 14:45843473-45843495 GTGCTGGGATGGAATGAAAATGG + Intergenic
1116953068 14:50896295-50896317 GGGGTGGTATGGAGGGAGAATGG - Intronic
1116965451 14:51010268-51010290 GTTCTGTTATTGAGGGACACAGG + Intronic
1118624029 14:67640649-67640671 GTCCTGGTATTGGTGGGAAAGGG - Intronic
1119098499 14:71856553-71856575 GTGGTAGTATTGAGAGAAAATGG - Intergenic
1119447151 14:74675154-74675176 GTGATGGTAATGAGGGAAATGGG - Intronic
1120539064 14:85732914-85732936 GTGGTGGTATGGAGAGATAATGG + Intergenic
1120612514 14:86659854-86659876 GTGCTGATATCTGGGGAAAAAGG + Intergenic
1120811737 14:88811017-88811039 GTGCTTATGTTGTGGGAAAAAGG + Intergenic
1121019685 14:90572137-90572159 GGGCTGGAATCGAGGGAAAAAGG - Intronic
1124071381 15:26396269-26396291 GTGCTGGACTGGAGGGAAATTGG + Intergenic
1124345062 15:28916692-28916714 GGCCTGTTTTTGAGGGAAAATGG - Intronic
1125202450 15:37111739-37111761 GTCTTGGTAGTGAGTGAAAACGG - Intergenic
1126419560 15:48457111-48457133 GTGCCTATATTTAGGGAAAAAGG + Intronic
1127162657 15:56205983-56206005 CTGCTGGTAGGGATGGAAAATGG + Intronic
1127209310 15:56756686-56756708 TTGCAGATATTGAGGGACAATGG - Intronic
1128932337 15:71716741-71716763 CTGCTTGGTTTGAGGGAAAAAGG - Intronic
1130695706 15:86129337-86129359 GTCCTGGCTTTGAGTGAAAATGG + Intergenic
1131281995 15:91029188-91029210 GTGCTGGTGTTGAGGGTGACTGG + Intergenic
1132266256 15:100473690-100473712 GTGCTGGTAGGGATGCAAAATGG + Intronic
1135158795 16:20075244-20075266 TTGCTGGTCTTGAGGGACAGGGG - Intergenic
1135565145 16:23506272-23506294 GTGCTGCAATGGAGGGATAAGGG - Intronic
1139358327 16:66380726-66380748 GTGGTGGTAGTGATGGTAAAGGG + Intronic
1139676200 16:68525557-68525579 GTGCCAGTATCGAGGGAAACTGG + Intergenic
1141851111 16:86646628-86646650 TAGCTGGGATTGAAGGAAAAGGG + Intergenic
1143180402 17:4980810-4980832 CTGCTTGTTTTGAGGGGAAATGG - Intronic
1145031543 17:19508075-19508097 GTGCTGGAATTCAGGAAAGAGGG + Intronic
1145924950 17:28639864-28639886 GTACTGGTACTGAGCGAGAATGG - Intronic
1146597278 17:34180918-34180940 TTGTTGGTATTGATGCAAAATGG + Intergenic
1146673950 17:34760254-34760276 GGGCTTATAGTGAGGGAAAAGGG + Intergenic
1147319410 17:39636921-39636943 GGCCTGGCACTGAGGGAAAAAGG - Intergenic
1147743433 17:42681480-42681502 GTGCTGGTATTGGAGGTACAGGG - Intronic
1147907824 17:43834046-43834068 CTGCTGGGATTGAGGGAAGGGGG - Intergenic
1148738135 17:49876222-49876244 GTGCTGGAATAAAGGGAAAAGGG - Intergenic
1148982671 17:51592217-51592239 ATGCTGGTATTGAAGATAAAAGG + Intergenic
1150860487 17:68796053-68796075 GGGGTGGTATGGAGGGATAATGG + Intergenic
1151757491 17:76083067-76083089 GTGCTGGACTCTAGGGAAAATGG + Exonic
1152388222 17:79987726-79987748 GAGCTGGTTCTCAGGGAAAAGGG + Intronic
1152419279 17:80183355-80183377 GTGCTGGAACACAGGGAAAATGG - Intronic
1154208178 18:12355466-12355488 TTGCTGGTAGGGATGGAAAATGG + Intronic
1155007568 18:21741725-21741747 GTGGTGGTAGTGTGGGACAACGG + Exonic
1155774125 18:29737550-29737572 CTGCTGGTAATGTGGCAAAATGG + Intergenic
1157799882 18:50610426-50610448 GTTCTGGGAGTGTGGGAAAATGG + Intronic
1158370568 18:56797964-56797986 GTGATGGTAGTGATGGAAAGTGG - Intronic
1158562947 18:58530828-58530850 GGGCTAGTGTTGAGGGAAAACGG + Intronic
1160596235 18:79976387-79976409 GTGCTGGCTTTGAGGGTAACTGG + Intronic
1163259031 19:16175689-16175711 TTGCTGGTGTTGATGCAAAATGG + Intergenic
1164055451 19:21618262-21618284 ATGGTGGTATTTAGAGAAAAAGG + Intergenic
1164398221 19:27884762-27884784 GTGCTGTTACTGAGGATAAAGGG - Intergenic
1164956788 19:32393117-32393139 GTGCTGATAAGGAGGGAAAGAGG + Intergenic
1165139326 19:33689471-33689493 GTGCTGGGCTTGGGGGAAAGGGG + Intronic
1167180947 19:47903117-47903139 GTGCAGGGATTGAGGGGAAAGGG - Intergenic
1167620995 19:50560617-50560639 GTGTTGGTGTTGAGGAAAACTGG + Intronic
925067740 2:941844-941866 GTGCACGTATTGAGCCAAAATGG + Intergenic
927352982 2:22140531-22140553 GTGATGGTATTACGGGAAAATGG - Intergenic
927712973 2:25337007-25337029 GTGCTGGCTTTGAGGGGACACGG - Intronic
928059990 2:28102251-28102273 TCTCTGGTATTGAGGGAAAAAGG - Intronic
929138926 2:38650511-38650533 GGGCTGGTATAGAGGGAGATGGG - Intergenic
929789111 2:45010721-45010743 GTGCTGGTCCTGTGGGAGAAGGG + Intergenic
930575651 2:53143826-53143848 GCGTTGGTATAGAAGGAAAAAGG + Intergenic
933496025 2:83051813-83051835 GTACTGGGATTGAGATAAAATGG + Intergenic
934142087 2:89056432-89056454 GTGGTGGTATGGAGAGAGAATGG - Intergenic
935208509 2:100918789-100918811 TTGCTGGTAGGGAGGTAAAATGG + Intronic
936605224 2:113945361-113945383 GTGATGGTATTGCAGGAACATGG + Intronic
936667671 2:114615730-114615752 GTACTTGTAGGGAGGGAAAAGGG + Intronic
936793825 2:116184238-116184260 GGGCTGGTATGGAGAGATAATGG + Intergenic
938152771 2:128901348-128901370 GTCCTGGTATTTAGGGAAAGTGG + Intergenic
938718545 2:134043608-134043630 CTGCTGATACTGAGGCAAAAAGG + Intergenic
938768797 2:134482383-134482405 GTGTTGGTCTTTAGGGGAAAGGG - Intronic
938967924 2:136404893-136404915 GTGCTGCTAGTGAGAGGAAAAGG - Intergenic
939294583 2:140243734-140243756 GTGCTGGTATCAAGAGAACAAGG - Intronic
940624971 2:156162968-156162990 GGGTTGGTTTTGAGAGAAAATGG - Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941388947 2:164888127-164888149 GGTCTGGCATTCAGGGAAAAGGG - Intergenic
942423499 2:175834376-175834398 ATGCTGCTTTTGTGGGAAAAAGG - Intergenic
944082490 2:195804033-195804055 GGGCTGGTTTTGAGGGGAGAGGG + Intronic
944573157 2:201064885-201064907 GTGTTCCCATTGAGGGAAAATGG - Intronic
945106156 2:206316908-206316930 GTGTTGGTCCTTAGGGAAAAAGG + Intergenic
945624003 2:212177562-212177584 GAGCTTGTATTAAGGGAAAAAGG - Intronic
945938739 2:215927577-215927599 GGGGTGGTATGGAGGGAGAATGG - Intergenic
946814503 2:223562939-223562961 GAGATGGTATTTAGGGAACAGGG + Intergenic
947410522 2:229833608-229833630 GTGCTGGTTTTGACAGAAATTGG + Intronic
947708125 2:232292869-232292891 GTCCTGGTATTGAGTGAAGAGGG - Intronic
947777870 2:232728797-232728819 GTGCTGGTAATGGAGGAAAAGGG + Intronic
948391109 2:237612147-237612169 GGGCTGGTATGGAGAGATAATGG - Intergenic
948618056 2:239214256-239214278 GTGCTGGTGTTGAGGAGAGAAGG - Intronic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1172842879 20:37912611-37912633 AGGCTGGTATTGAGGCAAACAGG - Intronic
1173652572 20:44676212-44676234 GGGCTGGTATGGAGAGATAATGG - Intergenic
1173817711 20:46000438-46000460 GTGCTGGGATGCAGGGAAGATGG - Intergenic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1175015671 20:55787309-55787331 GTTCTGCTTTGGAGGGAAAAAGG + Intergenic
1177103131 21:16919400-16919422 GTGATGGTATGGAGAGATAATGG - Intergenic
1178712588 21:34932299-34932321 GAGCTGGTTTTGAGGAAAAGAGG + Intronic
1179212456 21:39336885-39336907 GTGATGGAATTGAAGGGAAACGG - Intergenic
1180317049 22:11284633-11284655 GTGTGGGTATTGTGAGAAAAAGG - Intergenic
957381781 3:79440293-79440315 GTGCAGGTAATGAGGGATAGGGG - Intronic
961836296 3:129663308-129663330 GAGCAGGTATTGAGAGAAACAGG + Intronic
961847072 3:129774692-129774714 GTGCTTGTTTTGTGGGGAAATGG + Intronic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
963018369 3:140847769-140847791 TTGCTAGTATTCAGGGACAATGG - Intergenic
963478514 3:145837323-145837345 GAACTGGTATTTAAGGAAAATGG + Intergenic
964665544 3:159168031-159168053 GTCCTAGAATTGGGGGAAAAAGG - Intronic
964890443 3:161528277-161528299 GGGCTGGTATCTAGGAAAAATGG - Intergenic
967158680 3:186716552-186716574 TTGCTGGCTTTGAGGGAGAAGGG + Intergenic
968927064 4:3554976-3554998 GTGCTGGTGTTACTGGAAAAGGG + Intergenic
970715329 4:18915165-18915187 GTGCTTTTAGTGAGTGAAAAGGG + Intergenic
972241158 4:37193926-37193948 GTGCTGTTACTAAAGGAAAAAGG + Intergenic
972457510 4:39269041-39269063 GTGCTGGGATTTGGGGAAATGGG + Intronic
976953744 4:90867675-90867697 GTGGAGGTATTGGGGGAAGAGGG - Intronic
977782013 4:100992165-100992187 GGGGTGGTATGGAGGGATAATGG + Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982341489 4:154303693-154303715 GTCCTGGTATTGAAGAAAGAAGG + Intronic
982471363 4:155794458-155794480 TTGATGGTGTTAAGGGAAAAGGG + Intronic
984842694 4:184082810-184082832 GTGAAGTAATTGAGGGAAAATGG + Intergenic
985120775 4:186639518-186639540 GGAATGGTATTGAGGGATAAAGG + Intronic
986368160 5:7055515-7055537 GGGCTGGTATGGAGAGATAATGG + Intergenic
987996099 5:25281692-25281714 GTTCTGGTATTGAGCTAATAAGG - Intergenic
992269382 5:75050664-75050686 GTGCTGGTATTTACGGAAACAGG - Intergenic
992493022 5:77263931-77263953 GGGCTGCTAATGAGAGAAAATGG - Intronic
994827807 5:104738124-104738146 ATGCTATTTTTGAGGGAAAATGG + Intergenic
998311060 5:141132647-141132669 ATGCTGGTAATGAGAGCAAAAGG + Intronic
1002347163 5:178556032-178556054 GTGCTGTGATGGAGGGAAGAAGG - Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1004144718 6:13054729-13054751 GTGCTGGTATTTGGAGAAAGGGG - Intronic
1005606254 6:27480620-27480642 GTGCTAATATTGAGGGAATTGGG + Intergenic
1005928369 6:30463397-30463419 GAGCTGGGACTGAGGGGAAAAGG + Intergenic
1010880565 6:81164173-81164195 GTGGGGATATTGAGTGAAAAGGG - Intergenic
1012689822 6:102296799-102296821 GGGGTGGTATGGAGGGAGAATGG - Intergenic
1012816585 6:104030093-104030115 GGGCTGGAATTGAGGCAGAAGGG - Intergenic
1013462802 6:110391662-110391684 GTGCTGGTATTGAAGTAAAGAGG - Intergenic
1013662358 6:112310362-112310384 GTGCTGGGATTATGGGAATAGGG + Intergenic
1014850765 6:126337191-126337213 GTGCTGATATTAAGAGATAAGGG - Intergenic
1016197385 6:141361692-141361714 GTGCTGGTAGTGGGGACAAAGGG - Intergenic
1017240438 6:152162377-152162399 ATGATGGTAGAGAGGGAAAAAGG - Intronic
1019498183 7:1350658-1350680 CTGCTGGTAGGCAGGGAAAAAGG - Intergenic
1019641389 7:2105631-2105653 GTGAAGGTTCTGAGGGAAAATGG + Intronic
1020698775 7:11450266-11450288 GTGCAGGTATATGGGGAAAAGGG - Intronic
1021401774 7:20217884-20217906 GTGCTGATGTAGAGGGAAAGGGG - Intergenic
1023175561 7:37432345-37432367 GTACTTGTATTGAGGGAGAAAGG + Intronic
1025636558 7:63325036-63325058 GTGCTGGTATTGAGGGGAAAAGG + Intergenic
1025646138 7:63423066-63423088 GTGCTGGTATTGAGGGGAAAAGG - Intergenic
1025724946 7:64047810-64047832 GTGCTGGTATTGAGGGAAAAAGG + Intronic
1025753980 7:64316363-64316385 GTGCTGATATTGAGGGGAAAAGG + Intronic
1028646128 7:93098679-93098701 CTGCTGGCATTGAGGAAATAAGG + Intergenic
1028687758 7:93611557-93611579 GGGCTGGTTTTGAGGGAAAAGGG - Intronic
1029302881 7:99598601-99598623 GTCCTGGCATTCAGGGGAAAGGG + Intronic
1029690234 7:102176330-102176352 TTGCTTGTATTGTGGGGAAAGGG - Intronic
1030445337 7:109642216-109642238 GTGGTGGTATGGAGGGATAATGG + Intergenic
1030498236 7:110327210-110327232 GTGGTGATATTGAGAGAAATCGG + Intergenic
1031146395 7:118002026-118002048 GTGATGGTATTTGGGGAAAGGGG - Intergenic
1032945882 7:136851901-136851923 GAGCTGGTATGGAGGGAGAGGGG + Intergenic
1037223309 8:16552846-16552868 GTGTTGGAGTTGAGAGAAAAAGG + Intronic
1037308449 8:17530003-17530025 GTGCTGGTGTTGAATGCAAATGG - Intronic
1038047604 8:23779355-23779377 GGGGTGGTGCTGAGGGAAAATGG + Intergenic
1038355416 8:26824617-26824639 ATGCTGGCATTGAGCAAAAAGGG - Intronic
1038578120 8:28722826-28722848 GGGCTGGGACAGAGGGAAAAGGG - Intronic
1041476901 8:58277365-58277387 TTGCTGGTATTGTGTGAAACTGG + Intergenic
1042659938 8:71143152-71143174 TTGCTGGTCTTGAGGTAGAAAGG - Intergenic
1044329335 8:90898277-90898299 GTGGTGGTAGTGATGGAAGAGGG - Intronic
1045445103 8:102253930-102253952 GTTCTTGTATAGAGGGAATAGGG - Exonic
1046320021 8:112560994-112561016 TTGCTGGTGATGAGGTAAAATGG + Intronic
1046322940 8:112601726-112601748 TTCCTGGTATTGGGGAAAAAGGG + Intronic
1046353883 8:113053086-113053108 GGGTTGGTAGTGAGGGAGAAGGG - Intronic
1046863369 8:119119076-119119098 ATTCGGCTATTGAGGGAAAAAGG - Intergenic
1048734119 8:137479337-137479359 GTGCTGGTACAGGTGGAAAATGG + Intergenic
1048799385 8:138182056-138182078 GTGCTGTGAGTGAGGGAACAAGG - Intronic
1049027234 8:140001770-140001792 CTGCTAGTAGTGATGGAAAATGG + Intronic
1051475004 9:17496512-17496534 GTGATGGTATTAAGAGATAAGGG - Intronic
1052221005 9:26022428-26022450 GTGCAGGGAATGGGGGAAAATGG + Intergenic
1053078042 9:35151670-35151692 GGAGTGGTATGGAGGGAAAATGG + Intergenic
1053350750 9:37411893-37411915 GTGCAGGTTCTGAGGAAAAAGGG - Intergenic
1053405314 9:37870138-37870160 CTGCTGGTTTTGAAGGAAGAAGG - Intronic
1053801988 9:41770364-41770386 GTGCTGGTGTTACTGGAAAAGGG + Intergenic
1054143281 9:61544925-61544947 GTGCTGGTGTTACTGGAAAAGGG - Intergenic
1054190365 9:61982059-61982081 GTGCTGGTGTTACTGGAAAAGGG + Intergenic
1054462991 9:65475806-65475828 GTGCTGGTGTTACTGGAAAAGGG - Intergenic
1054648098 9:67606067-67606089 GTGCTGGTGTTACTGGAAAAGGG - Intergenic
1056406936 9:86283471-86283493 GTGCTAGAAGTGAAGGAAAAAGG + Intergenic
1057452330 9:95175793-95175815 GTGCAGGTGTTCTGGGAAAAGGG + Intronic
1057938942 9:99263796-99263818 GTGAAGGTGTTGATGGAAAAAGG - Intergenic
1058936926 9:109778446-109778468 GTGCTGGAAATGAAGAAAAAAGG + Intronic
1186461980 X:9755023-9755045 GTTATGTTACTGAGGGAAAAAGG - Intronic
1187440606 X:19315074-19315096 GGGCTGGGAGTGAGGGAAATGGG - Intergenic
1188879216 X:35471387-35471409 ATGCTGGTATTTAGGGGAGATGG + Intergenic
1189121386 X:38398986-38399008 GGGAGGGAATTGAGGGAAAAAGG - Intronic
1189238437 X:39506991-39507013 GAGCTGATAATGAGGGAAGAGGG + Intergenic
1191884900 X:65878257-65878279 GTTGTGGTTTTGAGGGAAAAGGG - Intergenic
1192210052 X:69122043-69122065 CTCCTGGTATGCAGGGAAAATGG + Intergenic
1192282306 X:69699709-69699731 TCGCTGGTATAGAGGGAGAAAGG + Intronic
1192310207 X:70005609-70005631 GTGTAGGTATTGAGGGAAAGTGG + Intronic
1194185828 X:90773837-90773859 GGGGTGGTATGGAGAGAAAATGG + Intergenic
1194793160 X:98176349-98176371 ATAGTGGTTTTGAGGGAAAAAGG - Intergenic
1195827479 X:109018022-109018044 GTGATGGTCTTAAGGAAAAAGGG - Intergenic
1196725361 X:118890375-118890397 CTGGTGGTATTGTGGGAAAGGGG + Intergenic
1197180239 X:123527557-123527579 GGGCTGGCATAGAGGGAAACTGG - Intergenic
1197441766 X:126500201-126500223 TTGCTGGTGTGAAGGGAAAATGG - Intergenic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199668561 X:150121411-150121433 GTGCTAGTATGGAGAGGAAATGG - Intergenic
1200698891 Y:6385536-6385558 GTGCTGATATTGAGGGCTATTGG - Intergenic
1201035221 Y:9779163-9779185 GTGCTGATATTGAGGGCTATTGG + Intergenic
1201581772 Y:15517577-15517599 GGGATGGTATGGAGGGATAATGG - Intergenic
1201725103 Y:17142169-17142191 GAGCTGTTATTGAGAGATAATGG + Intergenic