ID: 1025730546

View in Genome Browser
Species Human (GRCh38)
Location 7:64103169-64103191
Sequence TGGAGTGACAGCAGCACCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 113}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025730546_1025730558 25 Left 1025730546 7:64103169-64103191 CCCACGGTGCTGCTGTCACTCCA 0: 1
1: 1
2: 2
3: 10
4: 113
Right 1025730558 7:64103217-64103239 AAGGAACAGGCAGCTTCGGGGGG 0: 2
1: 2
2: 1
3: 13
4: 191
1025730546_1025730560 30 Left 1025730546 7:64103169-64103191 CCCACGGTGCTGCTGTCACTCCA 0: 1
1: 1
2: 2
3: 10
4: 113
Right 1025730560 7:64103222-64103244 ACAGGCAGCTTCGGGGGGCCGGG No data
1025730546_1025730554 21 Left 1025730546 7:64103169-64103191 CCCACGGTGCTGCTGTCACTCCA 0: 1
1: 1
2: 2
3: 10
4: 113
Right 1025730554 7:64103213-64103235 GCTCAAGGAACAGGCAGCTTCGG 0: 4
1: 0
2: 3
3: 34
4: 366
1025730546_1025730556 23 Left 1025730546 7:64103169-64103191 CCCACGGTGCTGCTGTCACTCCA 0: 1
1: 1
2: 2
3: 10
4: 113
Right 1025730556 7:64103215-64103237 TCAAGGAACAGGCAGCTTCGGGG 0: 3
1: 0
2: 1
3: 7
4: 149
1025730546_1025730555 22 Left 1025730546 7:64103169-64103191 CCCACGGTGCTGCTGTCACTCCA 0: 1
1: 1
2: 2
3: 10
4: 113
Right 1025730555 7:64103214-64103236 CTCAAGGAACAGGCAGCTTCGGG 0: 2
1: 0
2: 1
3: 12
4: 204
1025730546_1025730559 29 Left 1025730546 7:64103169-64103191 CCCACGGTGCTGCTGTCACTCCA 0: 1
1: 1
2: 2
3: 10
4: 113
Right 1025730559 7:64103221-64103243 AACAGGCAGCTTCGGGGGGCCGG No data
1025730546_1025730557 24 Left 1025730546 7:64103169-64103191 CCCACGGTGCTGCTGTCACTCCA 0: 1
1: 1
2: 2
3: 10
4: 113
Right 1025730557 7:64103216-64103238 CAAGGAACAGGCAGCTTCGGGGG 0: 3
1: 2
2: 0
3: 15
4: 155
1025730546_1025730553 12 Left 1025730546 7:64103169-64103191 CCCACGGTGCTGCTGTCACTCCA 0: 1
1: 1
2: 2
3: 10
4: 113
Right 1025730553 7:64103204-64103226 ACACATCGTGCTCAAGGAACAGG 0: 3
1: 2
2: 0
3: 6
4: 83
1025730546_1025730552 6 Left 1025730546 7:64103169-64103191 CCCACGGTGCTGCTGTCACTCCA 0: 1
1: 1
2: 2
3: 10
4: 113
Right 1025730552 7:64103198-64103220 CTTGCTACACATCGTGCTCAAGG 0: 3
1: 2
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025730546 Original CRISPR TGGAGTGACAGCAGCACCGT GGG (reversed) Intronic
901171650 1:7262744-7262766 TGGTGTGACAGAAGCAACCTGGG - Intronic
902520474 1:17012869-17012891 TGGAGTGCCAGCACCACTGTGGG + Intergenic
902612122 1:17603471-17603493 GGGAGAGAGAGCACCACCGTGGG - Intronic
903180758 1:21603683-21603705 TGGAGTGGCGGCAGCTCCGATGG - Intronic
903184199 1:21620180-21620202 GGGAGTGACGGGAGCATCGTGGG + Intronic
903562237 1:24236610-24236632 TGGGGAGACAGCAGCACAGAGGG + Intergenic
913544577 1:119854668-119854690 TGAAGTGACAGCGGCTCCTTGGG - Intergenic
919566512 1:199195554-199195576 TAGAGTGAAAGCTGCACTGTTGG - Intergenic
1069864191 10:71491289-71491311 TGGACTGACAGCAGCACTGGGGG - Intronic
1071153619 10:82664783-82664805 TGGAGTGAAAGCTGGACGGTGGG - Intronic
1077134382 11:991296-991318 CGGATTGAGAGCAGGACCGTGGG + Intronic
1077721958 11:4638498-4638520 TGGAGTAACAGCAGCAGCACTGG + Intergenic
1077819903 11:5727098-5727120 TGGGCTGACAGCTGCACTGTTGG + Intronic
1078264699 11:9746041-9746063 TTGAGTGACAGCAGGAGCGATGG - Intronic
1078929687 11:15903588-15903610 TGGAGTGACAGCAACACATCTGG - Intergenic
1079284952 11:19120229-19120251 TGGAGAGACTGCAGCAGGGTTGG + Intronic
1079970800 11:27032480-27032502 TGCAGTGGCAGCAGCACGGTGGG - Intergenic
1083132082 11:60634002-60634024 TGAGGTGACAGCATCACCATAGG + Intergenic
1083414139 11:62514355-62514377 TTGAGTGAAAGCAGCACCCCGGG + Intronic
1091711328 12:2742535-2742557 TGAAGTGACAGAAGGACCGAGGG + Intergenic
1094666072 12:32522384-32522406 TGGGGTAACAGCAGCAACTTGGG - Intronic
1097965146 12:65571176-65571198 TAGAGTGGCAGCAGCTCCCTTGG - Intergenic
1098753131 12:74321639-74321661 TGGTGTTACAGCAGCATCTTTGG + Intergenic
1098875621 12:75863833-75863855 TGGACTGAGAGTTGCACCGTTGG + Intergenic
1099542200 12:83926445-83926467 TTGGGAGACAGCAGCACCCTTGG - Intergenic
1108557982 13:51614490-51614512 TGGAAAGGCAGCAGCACCATGGG - Intronic
1113171197 13:107505155-107505177 TGGGGTGATGGCAGCACCATGGG + Intronic
1117208328 14:53469232-53469254 AGGAGTCACAGCATCACTGTGGG - Intergenic
1117881233 14:60315537-60315559 TGGAATGACAGCAGCCCCTCTGG - Intergenic
1122204561 14:100142119-100142141 TGGAATGACAGCAGCTCAGGTGG - Intronic
1125301042 15:38253113-38253135 GGGAGCAACAGCAGCACCGAGGG - Exonic
1130535710 15:84783732-84783754 TGCAGTGACAGCAGCAGCAAAGG + Exonic
1130766473 15:86876352-86876374 TGGAGGGAAAGCTGCACCGATGG + Intronic
1133126656 16:3651689-3651711 TGGAGAGACTGCAGCTCCCTGGG - Intronic
1136063299 16:27741561-27741583 TGGAGTGGCAGCCGCCCTGTGGG - Intronic
1137788641 16:51155841-51155863 TTGAGTGACAGCAGTTCAGTAGG - Intergenic
1138683882 16:58707667-58707689 TGGAGTGGCAGCAGCCTCATTGG + Exonic
1138767963 16:59626602-59626624 TGGAGGGAGAGCAGCACAGATGG - Intergenic
1140832392 16:78764019-78764041 TGGAGTGGCACCAGCTGCGTAGG + Intronic
1140944954 16:79759297-79759319 AGGAGAGACAGCAGGAACGTAGG - Intergenic
1142052083 16:87965410-87965432 AGGAGGGAGGGCAGCACCGTGGG + Intronic
1148512596 17:48185239-48185261 GGGAGGGACAGCAGCACAGGGGG + Intronic
1151577061 17:74958227-74958249 AGGAGGGACAGAGGCACCGTGGG + Intronic
1153652973 18:7257576-7257598 GGCAGTGACAGCAGCAATGTTGG - Intergenic
1158934219 18:62349619-62349641 TGCAGTGACTGCAGCACCCTGGG - Intronic
1161318842 19:3631861-3631883 TGGAGTGGAAGCTGCACCTTTGG - Exonic
1161343048 19:3753141-3753163 TGGAGAGACAGCCGCATCTTGGG + Intronic
1162541754 19:11300884-11300906 TGGAGTTACAGCCACATCGTGGG + Intronic
1163506311 19:17709106-17709128 TGGAGTGAGAGTAGCACAGAGGG + Intergenic
1164044742 19:21527165-21527187 GGGAGTTACATCAGCACCGATGG + Intronic
1168494390 19:56837774-56837796 TTGAGTGACAGCAGGGCTGTTGG - Intronic
926340334 2:11899802-11899824 AGGAGAGACAGCAGCACCCAGGG - Intergenic
929118465 2:38464696-38464718 TGTAGTGGAAGCAGCACCCTTGG - Intergenic
934710452 2:96510786-96510808 TGGAGTTCCAGCAGCACTTTTGG - Intergenic
934845103 2:97657305-97657327 GGGAGTGGCAGCAGCAGCCTTGG + Intronic
935576470 2:104716819-104716841 TGGAGTGAGACCAGCACCTGTGG + Intergenic
936526851 2:113247137-113247159 TGGTGTCACAGGAGCACCTTGGG + Intronic
937859594 2:126697428-126697450 TGGAGTGACAGCTGAGCTGTTGG - Intergenic
938080017 2:128364873-128364895 TGGAGACACAGCAGCACCTGTGG + Intergenic
939275336 2:139991509-139991531 TGGTGGGACAGCTGCACTGTGGG + Intergenic
939800534 2:146701178-146701200 TGGAGTGACACAAGCACCCAGGG - Intergenic
948069188 2:235106186-235106208 TGGAGTGACAGGCTAACCGTGGG - Intergenic
1173959523 20:47060359-47060381 TGGAGTGACTGCAGCCATGTTGG - Intronic
1174130372 20:48340108-48340130 TGGTGTGACCGCAGCCCTGTGGG + Intergenic
1176383558 21:6125970-6125992 TGGAGACAGAGCAGCTCCGTGGG - Intergenic
1178705583 21:34870246-34870268 TGCAGTGACACCAACACCATGGG - Intronic
1179642899 21:42758894-42758916 CGGAGTGCCAGCAGGGCCGTTGG - Intronic
1179739912 21:43412268-43412290 TGGAGACAGAGCAGCTCCGTGGG + Intergenic
1180185850 21:46138850-46138872 TGGAGGGCCGGCCGCACCGTGGG - Intronic
1181562466 22:23713938-23713960 TAGAGTGAGAGCAGCACCGTGGG + Intergenic
1181757613 22:25035668-25035690 TGTAGTGACAGCAGCAGCAAGGG + Intronic
1183167488 22:36158765-36158787 TGGAGTGCAAGTAGCACCATCGG - Intronic
1183373393 22:37448501-37448523 TGGAGAGAGTGCAGCATCGTAGG - Intergenic
1184693146 22:46126420-46126442 GGGAGTGACAGCAGAACCAGGGG - Intergenic
952638144 3:35557005-35557027 TGGAGTGACATCAGCAGAATAGG + Intergenic
957622023 3:82605306-82605328 TGGAGTGACACAAGCACCACTGG - Intergenic
961020560 3:123502902-123502924 AGGAGTGAGAGCAGCAGGGTGGG + Intronic
961493059 3:127268768-127268790 TGCAGGAACAGCAGCACTGTGGG + Intergenic
962074130 3:132062928-132062950 TGGACTGACAGAGGCACTGTAGG - Intronic
967142320 3:186571127-186571149 TGGGGTGAGAGGAGAACCGTGGG + Intronic
968425821 4:522567-522589 TGCAGTGGCAGCAGGACTGTTGG + Intronic
968849766 4:3071192-3071214 TGGAGTCACAGCAGCTCAGACGG + Intergenic
969174536 4:5388512-5388534 TGCAGTCACTGCAGGACCGTAGG + Intronic
980998395 4:139803642-139803664 TGGGGTAACAGAAGCACAGTGGG - Intronic
989299791 5:39877374-39877396 TGCAGTGACAACAGTACAGTGGG - Intergenic
990703172 5:58497405-58497427 TGGAGTGACACCTGCTGCGTTGG + Intergenic
992436418 5:76759751-76759773 GGGAGTGACAGCAGCAGGGGAGG + Intergenic
994510390 5:100696065-100696087 TGGAGTGACAGCAGGAGAGTGGG - Intergenic
1000992699 5:167927482-167927504 GGGAGTGACATAAGCCCCGTTGG - Intronic
1001798206 5:174519697-174519719 AGGAGTGAGAGGAGCAGCGTGGG + Intergenic
1001804720 5:174573602-174573624 TGGAGTGGGAGCAGCTCCGCTGG - Intergenic
1002947162 6:1773561-1773583 TGGTGTGACAGCTTCACAGTGGG + Intronic
1004462422 6:15850185-15850207 TGGAGTGACAGGAGCGCTCTGGG - Intergenic
1014343185 6:120233755-120233777 TGGAGTCCCTGCAGCACCTTTGG - Intergenic
1014953110 6:127582785-127582807 TGGAGTGACAGGAGTACTCTTGG + Intronic
1014957628 6:127640633-127640655 AGGAGTGGCAGCAGCACAGAAGG + Intergenic
1016102871 6:140124708-140124730 GGGAGTGACAGCGGCATCATGGG + Intergenic
1021862177 7:24916827-24916849 TGGTGTAACAGCAGCACAGCTGG - Intronic
1023288782 7:38647199-38647221 TTGAGTGTCAGCAGCACCCCAGG + Intergenic
1024528275 7:50368298-50368320 TGGAGTCACAGTAGCACTGATGG + Intronic
1025227325 7:57177109-57177131 TGGAGTGAGAGCAGCACCGTGGG + Intergenic
1025230428 7:57200547-57200569 TGGAGTGAGAGCAGCACCATGGG + Intergenic
1025730546 7:64103169-64103191 TGGAGTGACAGCAGCACCGTGGG - Intronic
1026511113 7:71027934-71027956 TGGAGAGAAAGCAGAACCGTGGG - Intergenic
1026989173 7:74573578-74573600 TGGAATGAGATCAGCACCGAGGG + Intronic
1029358749 7:100072636-100072658 AGGAGAGACAGCAGCAGCGCGGG + Intronic
1029942438 7:104494820-104494842 TGGTGTTGCAGCAGCACCATGGG + Intronic
1032062469 7:128736563-128736585 TCGAGTGAGAGCAGCACTGAAGG - Intergenic
1034104512 7:148478723-148478745 AGGAGTGACAGCAGCACTTGTGG - Intergenic
1034348817 7:150403616-150403638 TGCAGTGACACCAGCACCCCAGG - Intronic
1038382154 8:27106120-27106142 TACAGTGACAGCAGCAGCATGGG + Intergenic
1040535362 8:48304458-48304480 GGAAGAGACAGCAGCACCGTGGG + Intergenic
1041427405 8:57738377-57738399 AGCAGTGACAGCAGCACAGTAGG + Intergenic
1046934560 8:119873877-119873899 GGCAGTGACAGCAGCACCAGCGG + Exonic
1048260891 8:132944168-132944190 TGGAGTGACAGCTTCACAGAAGG - Intronic
1049623404 8:143609405-143609427 TGGAGTGGGAGCAGCCCCGTGGG - Intronic
1049664139 8:143835584-143835606 TGGGGAGACTCCAGCACCGTGGG - Exonic
1056500112 9:87200566-87200588 TGGTGGGAAAGCAGCACCATGGG + Intergenic
1056707993 9:88967968-88967990 TGCAGTCACAGGAGCACCGAGGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1057818701 9:98315048-98315070 TGGAATGTCAGCAGCACAGGGGG - Intronic
1059264037 9:113009343-113009365 GTGAGTGATAGCAGCACAGTAGG - Intergenic
1193880049 X:86910745-86910767 TGGAGTGACACAAGCACCCTGGG + Intergenic
1197359821 X:125486621-125486643 TATAGTGACAGCAGAACTGTGGG - Intergenic
1199901119 X:152173340-152173362 TGGAGAGAAAGGAGCACAGTAGG + Intronic
1199979823 X:152914850-152914872 GGGAGGGACCGCAGCAACGTGGG + Intronic