ID: 1025733280

View in Genome Browser
Species Human (GRCh38)
Location 7:64125225-64125247
Sequence CTGTCATTATTCAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025733273_1025733280 23 Left 1025733273 7:64125179-64125201 CCTTTCACTTAGTGAGTTGGTGG 0: 1
1: 0
2: 1
3: 26
4: 393
Right 1025733280 7:64125225-64125247 CTGTCATTATTCAGGGAAGAGGG No data
1025733275_1025733280 -1 Left 1025733275 7:64125203-64125225 CCTGAGATTTCTTTTCCTTTCAC 0: 6
1: 108
2: 423
3: 504
4: 842
Right 1025733280 7:64125225-64125247 CTGTCATTATTCAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025733280 Original CRISPR CTGTCATTATTCAGGGAAGA GGG Intronic
No off target data available for this crispr