ID: 1025733808

View in Genome Browser
Species Human (GRCh38)
Location 7:64129413-64129435
Sequence GACCGATGGTGGCCAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025733803_1025733808 -5 Left 1025733803 7:64129395-64129417 CCACAGGGACAGAAAGCAGACCG 0: 1
1: 0
2: 10
3: 87
4: 482
Right 1025733808 7:64129413-64129435 GACCGATGGTGGCCAGGGACTGG No data
1025733801_1025733808 10 Left 1025733801 7:64129380-64129402 CCAGAATTCATAGATCCACAGGG 0: 2
1: 0
2: 1
3: 7
4: 110
Right 1025733808 7:64129413-64129435 GACCGATGGTGGCCAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025733808 Original CRISPR GACCGATGGTGGCCAGGGAC TGG Intronic
No off target data available for this crispr