ID: 1025738216

View in Genome Browser
Species Human (GRCh38)
Location 7:64173800-64173822
Sequence AACCCTTCTCCCAGGGCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025738216_1025738222 -4 Left 1025738216 7:64173800-64173822 CCCCACGCCCTGGGAGAAGGGTT 0: 1
1: 1
2: 1
3: 15
4: 116
Right 1025738222 7:64173819-64173841 GGTTAGGAGTTTGCAGCTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 103
1025738216_1025738225 9 Left 1025738216 7:64173800-64173822 CCCCACGCCCTGGGAGAAGGGTT 0: 1
1: 1
2: 1
3: 15
4: 116
Right 1025738225 7:64173832-64173854 CAGCTTCCGGCTTTGGTGGCAGG No data
1025738216_1025738224 5 Left 1025738216 7:64173800-64173822 CCCCACGCCCTGGGAGAAGGGTT 0: 1
1: 1
2: 1
3: 15
4: 116
Right 1025738224 7:64173828-64173850 TTTGCAGCTTCCGGCTTTGGTGG 0: 1
1: 0
2: 3
3: 15
4: 139
1025738216_1025738227 25 Left 1025738216 7:64173800-64173822 CCCCACGCCCTGGGAGAAGGGTT 0: 1
1: 1
2: 1
3: 15
4: 116
Right 1025738227 7:64173848-64173870 TGGCAGGCCTTTTCCTAATATGG No data
1025738216_1025738223 2 Left 1025738216 7:64173800-64173822 CCCCACGCCCTGGGAGAAGGGTT 0: 1
1: 1
2: 1
3: 15
4: 116
Right 1025738223 7:64173825-64173847 GAGTTTGCAGCTTCCGGCTTTGG No data
1025738216_1025738228 26 Left 1025738216 7:64173800-64173822 CCCCACGCCCTGGGAGAAGGGTT 0: 1
1: 1
2: 1
3: 15
4: 116
Right 1025738228 7:64173849-64173871 GGCAGGCCTTTTCCTAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025738216 Original CRISPR AACCCTTCTCCCAGGGCGTG GGG (reversed) Intronic
900645359 1:3706454-3706476 TACCCCTCTCCCCGGGCCTGCGG - Intronic
902406002 1:16183979-16184001 ACCTGTTCTCCCAGGGCCTGTGG - Intergenic
902799681 1:18821448-18821470 AGCCCTTCTCACAGGGCGTCAGG - Intergenic
904301159 1:29555865-29555887 AACCATGTTCCCAGGGCGAGGGG + Intergenic
905775181 1:40663751-40663773 GTCCCTTCTCCCAGGGCATGTGG - Intronic
911601108 1:99849386-99849408 AACCCATCTTCCAGGGCTTTTGG - Intergenic
913331469 1:117671594-117671616 AACCCTGGGCCCAGGGCGTTCGG - Intergenic
915093570 1:153443628-153443650 ATCACTTCTCCCATGGCCTGTGG + Intergenic
920246592 1:204592386-204592408 AACCCTTGTCACAGGCCGTGAGG + Intergenic
923564712 1:235068240-235068262 AAGCCGTCTGCCAGGGCGTCTGG + Intergenic
924875288 1:248096492-248096514 AAACATTTTCTCAGGGCGTGAGG + Intronic
1067567410 10:47349124-47349146 TACCTTTCTCCCAGGACCTGGGG - Exonic
1071928774 10:90441299-90441321 AACACTTCTCCCAAGGTCTGTGG + Intergenic
1073329599 10:102661572-102661594 ACCCCTTCTCCCAGCGCATCTGG + Intergenic
1075250261 10:120862789-120862811 AACTTTTTTCCCAGGGCCTGAGG - Exonic
1075533731 10:123252762-123252784 CACCCTTCTCCCCTGGGGTGAGG - Intergenic
1076117153 10:127908336-127908358 ACCCCTTGACCCAGGGCGTCTGG + Intronic
1076531158 10:131145840-131145862 AGCCCTCCTCCCAGAGCATGTGG - Intronic
1077142773 11:1031670-1031692 CACCCTTCGGCCAGAGCGTGCGG - Exonic
1077335139 11:2000096-2000118 AACCCTTCTCGCAGGGTCTCTGG - Intergenic
1077811488 11:5642284-5642306 AACCCTTCTCCCTGAGCCTGAGG - Intronic
1079533743 11:21485884-21485906 AACACTTTTCCCAGGGTTTGAGG + Intronic
1080418702 11:32091849-32091871 AGCCCTTCTCCCCGGGAGTGGGG - Intronic
1088455640 11:110030375-110030397 ACTCCTTCTCCCAGGGTGTGAGG - Intergenic
1089180907 11:116582257-116582279 AACTCTTTTCCCAGGAGGTGGGG - Intergenic
1090196468 11:124821035-124821057 ACTCCTTCTCCCAGGTGGTGTGG - Intergenic
1202818122 11_KI270721v1_random:55278-55300 AACCCTTCTCGCAGGGTCTCTGG - Intergenic
1094138953 12:27160708-27160730 ACCCCTTCACCCAGGTAGTGAGG - Intergenic
1100320926 12:93491708-93491730 AACCCATCACCCAGGCAGTGAGG + Intronic
1101930343 12:109008674-109008696 AACCCACCTCCTAGGGCATGAGG - Intronic
1104638036 12:130450090-130450112 TTCCCTTCTCCCAGGGCACGAGG - Intronic
1107963564 13:45579621-45579643 AACCCTGCTTCCAGGGCCTCAGG + Intronic
1108360545 13:49664772-49664794 AACCTTTGTCCCAGGCCCTGAGG - Intronic
1112285111 13:98097059-98097081 AAGCCATCTCCCAGGAAGTGGGG + Intergenic
1120730118 14:87992646-87992668 AACCCTCGTCCCAGGCAGTGGGG - Intronic
1121031816 14:90664689-90664711 AGCCCAGCTCGCAGGGCGTGAGG + Intronic
1121277360 14:92677389-92677411 AACCATCCTCCCAGGCCCTGAGG + Intronic
1123119137 14:105908932-105908954 ACCCCTTCTCCCAGGAGGGGAGG + Intergenic
1124165224 15:27320127-27320149 AAGCCTTCTCCCAGGCCTTGGGG + Intronic
1125883115 15:43210207-43210229 CCCCCTCCTCCCAGGGTGTGGGG - Intronic
1129468568 15:75738006-75738028 AACCCCTCTCCCAGCCCCTGGGG - Intergenic
1131126873 15:89866350-89866372 ACCCCTTCTCCCAGTGAGAGGGG + Intronic
1131397297 15:92096897-92096919 AACCCGTTTCCTAGGGAGTGTGG + Intronic
1131519769 15:93105291-93105313 AGTCCTTCTCCGAGGGCCTGGGG - Intergenic
1132682039 16:1146382-1146404 AAGCCTCCTCCGAGGGCATGGGG - Intergenic
1138266544 16:55663914-55663936 ATTCCTTCCCCCAGGGCCTGGGG - Intronic
1144941680 17:18946588-18946610 ATTCCTTCCCCCAGGGTGTGGGG + Intergenic
1146064905 17:29626691-29626713 AACCCTTCTCCCAGGGTGTGGGG - Exonic
1146535596 17:33647905-33647927 GACCCTTCTCCCAGGGAGGCAGG - Intronic
1148045021 17:44738187-44738209 AACCTTTCTCCCAGGGGTAGAGG + Intronic
1149055362 17:52356842-52356864 TGCCCTGCCCCCAGGGCGTGGGG + Intergenic
1150729800 17:67682460-67682482 GACTCTTATCTCAGGGCGTGAGG - Intronic
1151538733 17:74753367-74753389 AACCTCTTTCCCAGGGCGGGCGG + Intronic
1152877290 17:82794095-82794117 GGCCCTTCTCCCAGGGCCTCGGG + Intronic
1153955775 18:10094887-10094909 TACCCTTCTCCAAAGGCATGTGG + Intergenic
1153964359 18:10166622-10166644 AACCCTTGCCCCAGGGCCTGCGG + Intergenic
1159609454 18:70509807-70509829 AAGCCTTGTCCCAGGGGCTGGGG + Intergenic
1159908334 18:74119042-74119064 ATCCCGCCTCCCAGGGCCTGGGG - Intronic
1161716177 19:5877293-5877315 CACCCTTCTACCTGGGCCTGGGG + Intronic
1162451408 19:10757332-10757354 AACCCATCATCCAGGGTGTGTGG + Intronic
1162832998 19:13298728-13298750 GACCCTCCTCCCCGGGCCTGCGG + Exonic
1163130023 19:15266520-15266542 ACCCCTGGTCCCAGGGAGTGAGG + Intronic
1163184291 19:15626953-15626975 ATCCATTCTCCAGGGGCGTGTGG + Intronic
1163685404 19:18709360-18709382 AGCCCTTCTCCCACTGCCTGAGG - Intronic
1164412412 19:28016928-28016950 AACCCTTTTCCTGGGGTGTGGGG - Intergenic
1164483393 19:28633297-28633319 ACCACTTTTCCCAGGGCCTGAGG + Intergenic
1165772021 19:38385671-38385693 AACCCTTGTTCCTGCGCGTGCGG + Exonic
1166718921 19:44986529-44986551 TGCCCTTCACCCACGGCGTGTGG - Exonic
1168426296 19:56241930-56241952 AACCCGTCACCCAGGATGTGAGG + Intronic
927131730 2:20065984-20066006 GACCCTTCTGCCAGGGGTTGAGG + Intergenic
927173127 2:20387062-20387084 TAGCCTTCTACCAGGGCCTGTGG + Intergenic
934063914 2:88321920-88321942 AACCTCTCTGCCAGGGAGTGGGG - Intergenic
934709966 2:96508342-96508364 CACCCGTCTCCCAGGGTGGGTGG + Intergenic
937465645 2:122131098-122131120 AACACTTCTCCCAGGGTCTGAGG - Intergenic
939232971 2:139454579-139454601 AACATTCCTCCCAGGGCCTGAGG - Intergenic
942882876 2:180883633-180883655 AACACTTCTCCCAGGGTCTAAGG + Intergenic
946080447 2:217114038-217114060 AACCCTTCTCACAGGAAGCGTGG + Intergenic
948985865 2:241522820-241522842 GACCCTTCTCCCAGGGTGTGGGG - Intergenic
1171168467 20:22994164-22994186 GGTCCTTCTCCCAGGGCATGTGG - Intergenic
1173894730 20:46542042-46542064 AACCCGTTTCCCAGGGTTTGAGG + Intronic
1173929064 20:46803510-46803532 AGAGCTTCTCCCAGGGCCTGTGG + Intergenic
1174052486 20:47776710-47776732 AGCCCTTCTGCAAGGCCGTGAGG + Intronic
1176218048 20:63957455-63957477 AGCCCTCCTCCCAAGGGGTGGGG - Exonic
1179992336 21:44954517-44954539 CTCCCTTCTCCCAGGACCTGAGG - Intronic
1182161497 22:28126886-28126908 AACTCTTCTTCCAGGACATGTGG - Intronic
1183071728 22:35400754-35400776 AAGCCTTATACCAAGGCGTGAGG - Intronic
1183442686 22:37832113-37832135 GTCTCTCCTCCCAGGGCGTGTGG + Intronic
1183741431 22:39670657-39670679 AACACTGATCCCAGGGCCTGGGG + Intronic
1184102538 22:42348346-42348368 AGCCCCTGTCCCAGGGCATGAGG - Intergenic
950930604 3:16785150-16785172 ATTCCTTCTCCCAGGGTATGGGG + Intergenic
951317248 3:21203121-21203143 AACACTTCTCCCAGGGTCTGTGG - Intergenic
952243706 3:31562367-31562389 AACACTACTCCCAGGGTCTGAGG - Intronic
953710464 3:45265500-45265522 AACCCTTGTCCCAGGAGGTGGGG - Intergenic
956650229 3:71498178-71498200 AACCCAAATCCCAGGGCCTGTGG + Intronic
960024978 3:112998546-112998568 ATCCCTTCCCCCAGGGTATGAGG + Intronic
964277409 3:155023097-155023119 AATCCTTCTTCCAGGGTATGGGG - Intergenic
972721696 4:41705927-41705949 AACACGTCTCCCAGGGCACGTGG - Intergenic
973773821 4:54228280-54228302 AACCCTGCGCCCAAGGCGAGAGG - Intronic
981673625 4:147315408-147315430 CACCCTTCTCACAGGGCTAGTGG + Intergenic
982274404 4:153624592-153624614 TGCCCTTCTCACGGGGCGTGTGG - Intronic
989989004 5:50739239-50739261 ATCCCTTCTCCCAGGTGGAGAGG - Intronic
992533229 5:77672119-77672141 ATCCCTTTTCCCAGGGCTGGTGG + Intergenic
1000822044 5:165996762-165996784 AACCCTCCTCCCATTACGTGTGG + Intergenic
1007786138 6:44280382-44280404 CACCCTTCTCCCAGGACGGTGGG - Exonic
1007922293 6:45621289-45621311 AACCCCTCTCCCCGGAGGTGTGG - Intronic
1010410756 6:75558970-75558992 ATCCATTCTCCCAGGGAATGGGG - Intergenic
1011656101 6:89553369-89553391 AGGCCTTCTCCCAGGGCTGGAGG - Intronic
1016026404 6:139291879-139291901 ATACCTTCTCACAGGGCTTGGGG + Intronic
1016389280 6:143558929-143558951 TCCCCTTCTCCCAGGGAGTGGGG - Intronic
1018103524 6:160462701-160462723 AACCCTTCTCACAAGGCTTGGGG + Intergenic
1023142635 7:37117441-37117463 ACCCCTTGTCCCAGGGAGGGAGG - Intronic
1023605952 7:41931105-41931127 AACCCTCCTCCCGGGGCTTCAGG + Intergenic
1024427663 7:49246123-49246145 AACCCTTCACCCAGTCCATGGGG - Intergenic
1025738216 7:64173800-64173822 AACCCTTCTCCCAGGGCGTGGGG - Intronic
1029258209 7:99283743-99283765 AACACATCCCCCGGGGCGTGAGG + Intergenic
1031568673 7:123330661-123330683 AACACTTCTCCCAGAGTCTGAGG + Intergenic
1035096754 7:156362054-156362076 AGCCCTTCTCCCATGGAGTGCGG - Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1041245894 8:55888235-55888257 GCCCCTTCTTCCAGGGTGTGTGG - Intronic
1041669491 8:60478482-60478504 ATTCCTTCCCCCAGGGCATGGGG + Intergenic
1044964938 8:97565533-97565555 ACCCCGTTTCCCAGGACGTGGGG - Intergenic
1049491399 8:142905048-142905070 ACCACTTCCCCCAGGGCCTGAGG + Intronic
1050042086 9:1506677-1506699 AGCCCTGCTCCCAGGCCATGAGG - Intergenic
1056172279 9:83997543-83997565 CACCCTCCTCCCAGTGGGTGCGG - Intronic
1059519798 9:114930449-114930471 AACTCTTCTCTGGGGGCGTGAGG + Intronic
1060925166 9:127451041-127451063 AAGCCTTACCCTAGGGCGTGCGG + Intronic
1061024742 9:128041174-128041196 ATTCCTTCCCCCAGGGTGTGAGG - Intergenic
1061945244 9:133905044-133905066 GAGGCTTCTCCCAGGGCGGGGGG + Intronic
1062697137 9:137881182-137881204 ACCCCTTTTCCCAAGGGGTGGGG - Intronic
1185464156 X:345448-345470 CACCCTTCTCTCAGGGCCTGCGG - Intronic
1187311541 X:18149073-18149095 AACTCTGCTCCCAGGGGTTGAGG - Intergenic
1188994042 X:36860395-36860417 AACCCTTCTCCTTAGGCTTGAGG + Intergenic
1193046715 X:77061704-77061726 AAGCAGTCTCCCAGGGCCTGGGG + Intergenic
1200123024 X:153800189-153800211 AACCCCCCTCCCAAGGCCTGGGG - Intergenic