ID: 1025738501

View in Genome Browser
Species Human (GRCh38)
Location 7:64175343-64175365
Sequence CAGGGTCCTCTGTTGTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 2, 2: 1, 3: 21, 4: 171}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025738486_1025738501 30 Left 1025738486 7:64175290-64175312 CCCGCCCCACCCCAGGCCGGCTC 0: 1
1: 1
2: 10
3: 132
4: 1036
Right 1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG 0: 1
1: 2
2: 1
3: 21
4: 171
1025738491_1025738501 21 Left 1025738491 7:64175299-64175321 CCCCAGGCCGGCTCCATGCAGAT 0: 2
1: 0
2: 3
3: 10
4: 146
Right 1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG 0: 1
1: 2
2: 1
3: 21
4: 171
1025738498_1025738501 -7 Left 1025738498 7:64175327-64175349 CCAGAGTCACCAGTCTCAGGGTC 0: 1
1: 1
2: 0
3: 14
4: 157
Right 1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG 0: 1
1: 2
2: 1
3: 21
4: 171
1025738489_1025738501 25 Left 1025738489 7:64175295-64175317 CCCACCCCAGGCCGGCTCCATGC 0: 2
1: 0
2: 3
3: 32
4: 299
Right 1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG 0: 1
1: 2
2: 1
3: 21
4: 171
1025738487_1025738501 29 Left 1025738487 7:64175291-64175313 CCGCCCCACCCCAGGCCGGCTCC 0: 2
1: 0
2: 15
3: 128
4: 1171
Right 1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG 0: 1
1: 2
2: 1
3: 21
4: 171
1025738493_1025738501 19 Left 1025738493 7:64175301-64175323 CCAGGCCGGCTCCATGCAGATGC 0: 2
1: 0
2: 3
3: 24
4: 157
Right 1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG 0: 1
1: 2
2: 1
3: 21
4: 171
1025738495_1025738501 8 Left 1025738495 7:64175312-64175334 CCATGCAGATGCATTCCAGAGTC 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG 0: 1
1: 2
2: 1
3: 21
4: 171
1025738492_1025738501 20 Left 1025738492 7:64175300-64175322 CCCAGGCCGGCTCCATGCAGATG 0: 2
1: 0
2: 1
3: 18
4: 122
Right 1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG 0: 1
1: 2
2: 1
3: 21
4: 171
1025738494_1025738501 14 Left 1025738494 7:64175306-64175328 CCGGCTCCATGCAGATGCATTCC 0: 1
1: 1
2: 2
3: 16
4: 216
Right 1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG 0: 1
1: 2
2: 1
3: 21
4: 171
1025738488_1025738501 26 Left 1025738488 7:64175294-64175316 CCCCACCCCAGGCCGGCTCCATG 0: 2
1: 0
2: 2
3: 33
4: 439
Right 1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG 0: 1
1: 2
2: 1
3: 21
4: 171
1025738490_1025738501 24 Left 1025738490 7:64175296-64175318 CCACCCCAGGCCGGCTCCATGCA 0: 2
1: 0
2: 3
3: 17
4: 272
Right 1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG 0: 1
1: 2
2: 1
3: 21
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025738501 Original CRISPR CAGGGTCCTCTGTTGTAGGA TGG Intronic
900432237 1:2607820-2607842 TAGGGTCCTATGCTGGAGGAAGG + Intronic
902248817 1:15140040-15140062 CAGGGCCCTCTGATGTGGGACGG + Intergenic
910529883 1:88223773-88223795 CAGGGTCTTCATTTGTAAGAGGG + Intergenic
915123432 1:153647257-153647279 CAGTCTCCTCTGGGGTAGGAGGG - Intergenic
915572661 1:156753024-156753046 CAGTTTCCTCTGCTGTAAGATGG + Intronic
917505531 1:175623812-175623834 CAGGCTCCTCTGTAGTATGGGGG - Intronic
918363950 1:183787047-183787069 CACGTTCCTCTGTGCTAGGATGG - Intronic
919810481 1:201405955-201405977 CAGGGCCCCATGTTGGAGGAAGG + Exonic
920059136 1:203215635-203215657 CTCAGTCCTCTGCTGTAGGATGG - Intronic
920246896 1:204594704-204594726 ATGTGTCCTCTGTTGTTGGATGG + Intergenic
920390651 1:205598406-205598428 CCGTGTCCTCTGTTGTAAAAAGG - Intronic
920549070 1:206843292-206843314 CAGTGTCCTCTGTTGTAAAGTGG + Intergenic
923201523 1:231717277-231717299 CAAGGTCTTCAGTTGGAGGAAGG + Intronic
1067322956 10:45239708-45239730 CAGGATCCTCTGATGTCGCAGGG - Intergenic
1074965299 10:118486090-118486112 CAGCTTCCTCTTTTGTAGGATGG - Intergenic
1076067902 10:127463720-127463742 CAGGGACCCCTGATGCAGGAAGG - Intergenic
1077335161 11:2000196-2000218 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1077335339 11:2001009-2001031 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1079492331 11:21002605-21002627 CAGGGTAGACTGTTGTTGGATGG - Intronic
1084585063 11:70054521-70054543 TAGCCTTCTCTGTTGTAGGAAGG + Intergenic
1090749065 11:129730090-129730112 CAGGGGCCTATGATGCAGGATGG + Intergenic
1090968057 11:131615689-131615711 CAGGGGCCTCTGTTGTGTTATGG + Intronic
1202818144 11_KI270721v1_random:55378-55400 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1202818322 11_KI270721v1_random:56191-56213 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1093288104 12:17290783-17290805 CAGAGTCCTACATTGTAGGAAGG - Intergenic
1096095931 12:48935678-48935700 CAGGGCCATCAGTTGTAAGAAGG + Intronic
1101701672 12:107179649-107179671 CAGGGTCCTCTGTGGGATGCTGG - Intergenic
1101991103 12:109485854-109485876 CAGTGTCCTCATCTGTAGGAAGG + Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1104485584 12:129148923-129148945 CTGGCTCCTTTCTTGTAGGAAGG + Intronic
1105678325 13:22699760-22699782 TAGGATCCTCTCTTGTAGGAGGG - Intergenic
1106677712 13:31978671-31978693 CGGGGTTCTCTTTTGGAGGATGG + Intergenic
1108281609 13:48867523-48867545 CAGAGTCCTCTTTTTTAGGTTGG + Intergenic
1114645974 14:24256327-24256349 CAGGCTGCTCTGCTGGAGGATGG + Intronic
1115344742 14:32330247-32330269 CAGGGTCCTCAGTGGTTGTAGGG + Intronic
1116107615 14:40530586-40530608 CAGTGTTCTCTTTTATAGGAAGG - Intergenic
1118381674 14:65222623-65222645 CAGGGGCCTCTGGGGGAGGATGG + Intergenic
1118465138 14:66024013-66024035 CAGGGTACTCTATTCTAGGGTGG + Intergenic
1119062423 14:71488950-71488972 CAGGCTCCTCAGCTGCAGGATGG + Intronic
1119788366 14:77328961-77328983 CAGGGCCCTTGGTTGAAGGAAGG + Intronic
1120219370 14:81715077-81715099 CAAGGTCCTCAGTTGTTGGCTGG - Intergenic
1121566704 14:94915319-94915341 CAGGTTCCTCTCTTGTACAAAGG + Intergenic
1121755630 14:96399835-96399857 GAAGGTCATCTGTTGTAGGAAGG - Intronic
1122235115 14:100327036-100327058 CAGTTTCCTCTGCTGTAAGATGG - Intronic
1202904407 14_GL000194v1_random:60046-60068 CAGGGGCCTGTGCTGTAGGAAGG - Intergenic
1124094158 15:26633318-26633340 CAGGGTCAGCTGCAGTAGGATGG - Intronic
1125350209 15:38758836-38758858 CAGTGTCTTGTGTTGTAGAAAGG + Intergenic
1126353546 15:47770896-47770918 CAGGGTCTTCTGGTGAAGCACGG - Exonic
1130817400 15:87452256-87452278 CAGGTTCCTCTCTTGTGAGATGG + Intergenic
1130944817 15:88542927-88542949 CAGGCTCTTCTGTTGCAGGCAGG - Intronic
1131656338 15:94462771-94462793 CAGGGTCCTCATCTGTAGGATGG + Intronic
1131933179 15:97469291-97469313 CAGAGCCCTCAGTTGTTGGAAGG - Intergenic
1133033550 16:3022721-3022743 CAGTGTCCTCTGTTGAGGGAAGG + Exonic
1134307280 16:13044291-13044313 CAAATTCCTCTGTGGTAGGAAGG + Intronic
1135840567 16:25872478-25872500 CAGGGGCTTCTGTTCTAGGATGG + Intronic
1135884714 16:26295535-26295557 CATGGTCCCCAGTTGAAGGAGGG + Intergenic
1136400771 16:30016893-30016915 CAGGGTCCTATGAGGTAGGAGGG + Intronic
1136663058 16:31782139-31782161 AAGCTTTCTCTGTTGTAGGATGG + Intronic
1142382815 16:89743296-89743318 CTTTGTTCTCTGTTGTAGGAGGG - Intronic
1142616623 17:1140225-1140247 CAGGGTCCTCTGGGCTTGGAGGG + Intronic
1142693424 17:1620614-1620636 CAGGCGCCTCTGTTGCTGGACGG - Intronic
1144740997 17:17582150-17582172 CCGGGACCTCTGTTGTATGAAGG - Intronic
1145263676 17:21369239-21369261 CAGTCTCCTCAGCTGTAGGATGG - Intergenic
1146211464 17:30946821-30946843 CATGTGCCTCTGCTGTAGGAAGG + Intronic
1146260392 17:31416768-31416790 CAGGGTCCACTGCTGTAAGAGGG + Intronic
1147263901 17:39224039-39224061 CTGGGTCCCCTGGTGCAGGATGG + Intronic
1147782501 17:42953774-42953796 CTGTGTCCTTTGTTGTAGGAAGG - Exonic
1148835791 17:50465137-50465159 CTGGGTCCCCTGTTGAAGGGAGG - Intronic
1152165092 17:78698745-78698767 CAGGATCGTCTTTTGTAGGAAGG - Intronic
1152261327 17:79268834-79268856 CAATGTCCTCTGTGGGAGGAAGG - Intronic
1153238577 18:3011829-3011851 CAGCATCCTCAGTTGTTGGAGGG - Exonic
1154138356 18:11800744-11800766 CAGGCTTCTCTGTCATAGGAAGG + Intronic
1155117003 18:22778606-22778628 CAGGGTCCTCTTCTGTAAGATGG + Intergenic
1157221606 18:45832225-45832247 CAGGGTCCTCTGCTGCAAAATGG - Intronic
1158011217 18:52730175-52730197 CAGTGTTCTCTGGTGTGGGAGGG - Intronic
1158892225 18:61883480-61883502 CTTGCTCCTCTCTTGTAGGATGG + Intronic
1159555790 18:69943103-69943125 CAGTGTCTTCTGTTGTATTACGG + Intronic
1159778934 18:72638653-72638675 CAGGATGTTCTGTTGTAGCATGG - Intergenic
1164436289 19:28232721-28232743 CAGGGTCCTCAGATCCAGGAAGG + Intergenic
1166209564 19:41297492-41297514 TGGGGTCCTCTGTTGGAGGTGGG + Intronic
1166266977 19:41690517-41690539 CTGGTTCCTCTGTTATGGGAGGG + Intronic
1166547552 19:43642376-43642398 CAGGGTACCCTGAAGTAGGATGG - Intergenic
925052558 2:828604-828626 AAGGGTCCTCTGTAGAAGGATGG - Intergenic
928058724 2:28087520-28087542 CTGGGCCCTCTGTCGTACGAGGG + Intronic
928595497 2:32855723-32855745 CAGGGGCCTCTGCTCCAGGAGGG - Intergenic
928983329 2:37157329-37157351 CAGTTTCCTCTATTGTAGAATGG - Intergenic
931251457 2:60534411-60534433 CAGGTTCCTCCTTTGGAGGAGGG - Intronic
931441605 2:62294143-62294165 CAGGGTCTTCTTTTGTGGGAAGG - Intergenic
931460025 2:62442552-62442574 CTTGGTCCTCACTTGTAGGATGG + Intergenic
936902152 2:117493571-117493593 CAGTGTCCTGTGGTGAAGGACGG - Intergenic
937033071 2:118756983-118757005 CAGGGACCTCTGGTGTAAAATGG - Intergenic
938213756 2:129490797-129490819 CATGGTCCTCCCTTGTAGCATGG - Intergenic
938939998 2:136161673-136161695 GAGGGTGCTCTGTGGTAGGCAGG + Intergenic
939954883 2:148519461-148519483 CAGGGACCTGTGCTGGAGGAAGG - Intergenic
946769278 2:223071822-223071844 AAGTGTGCACTGTTGTAGGAAGG - Intronic
1170706647 20:18749748-18749770 CAGTGTCCTCTGTGGCAGGGTGG - Intronic
1174974273 20:55313789-55313811 CAGAGTCCTTGGTTGTAGCAAGG + Intergenic
1175193464 20:57226485-57226507 CTGGCTCCTCTGTTCTATGATGG - Intronic
1175954105 20:62599515-62599537 CAGGCTCCTCTGTCATGGGAGGG + Intergenic
1175986165 20:62765111-62765133 CAGGCTCCACTGTTGGTGGAGGG - Intergenic
1176623775 21:9074813-9074835 CAGGGGCCTGTGCTGTAGGAAGG - Intergenic
1176961142 21:15160385-15160407 CAAGCTCCTCTTTTGTAAGAAGG - Intergenic
1177752198 21:25298325-25298347 CAAGTTCCCCTGTGGTAGGATGG + Intergenic
1180238751 21:46483568-46483590 CAGGCTCTTCTTCTGTAGGATGG + Intronic
1180256707 21:46635016-46635038 CAGGGTCCCCTGGTAAAGGAGGG + Intergenic
1181055986 22:20260678-20260700 CAGAGTCCTCAGTTGTGGTAGGG - Intronic
1181491729 22:23264404-23264426 CAGGGACCTCTCTTGCATGAAGG + Intronic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1182116735 22:27760960-27760982 CAGTGTCCTCTGCTGTAAAATGG - Intronic
1183341163 22:37282620-37282642 CAGGGTGCTCTCTTTTAGAATGG + Intronic
1184938946 22:47746808-47746830 CTGGGTTTTCTGTTGTTGGAGGG + Intergenic
949562410 3:5214743-5214765 CAGTGTCTTCTCTTTTAGGAAGG + Intronic
950602237 3:14045041-14045063 TTGGGTGCTTTGTTGTAGGATGG + Intronic
961407622 3:126692877-126692899 CAGGTGCCTCAGCTGTAGGATGG - Intergenic
966678632 3:182616752-182616774 CATGGTCCTCTGATGAAGAAAGG - Intergenic
968041913 3:195595961-195595983 CAGAACCCTCTGCTGTAGGAGGG + Intergenic
968628664 4:1639070-1639092 CAGGGCCCTCTGCTGCAGGTCGG - Intronic
968926397 4:3550851-3550873 CAGGGTCTTCTGTGGTGGGGTGG + Intergenic
969322930 4:6424027-6424049 CAGGGTCCCCGGCTGGAGGAAGG + Intronic
969333807 4:6495066-6495088 CAGGGCCCTCAGCTGTGGGATGG - Intronic
976893964 4:90084857-90084879 AAGAGCCCTCTGTTGCAGGAGGG - Intergenic
977923548 4:102672591-102672613 TTGGGACCCCTGTTGTAGGATGG - Intronic
978381577 4:108134513-108134535 CAGTCTCCTCTTTTCTAGGATGG - Intronic
979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG + Exonic
980740997 4:136949611-136949633 CAGGGTTGTCTGTTGTCTGAGGG - Intergenic
981051857 4:140317136-140317158 CAGGGGACTCTCTTGTAAGATGG + Intronic
983300134 4:165914717-165914739 CAGGGTCCTCAGTTGTGACAAGG - Intronic
984863009 4:184256639-184256661 AAGGGTCCTGTGCTCTAGGAGGG - Intergenic
985685200 5:1278167-1278189 CAGGGTCCTCACTTCTAGCATGG - Intronic
985761170 5:1749626-1749648 CTGGGTCCTCAGTCCTAGGAAGG - Intergenic
988532095 5:32036908-32036930 AAGTGTCCTCAGGTGTAGGATGG + Intronic
989205988 5:38809447-38809469 CAGGAGGCCCTGTTGTAGGAGGG - Intergenic
999087622 5:148906961-148906983 CAGGGTTCTCTGATGAAGTAAGG + Intergenic
999554033 5:152721386-152721408 AAGAGTCCCCTGTTGTAGGGTGG - Intergenic
1001865929 5:175105405-175105427 CAGGGTCCTCTTCTGCAGCAGGG - Intergenic
1004482166 6:16031309-16031331 CAGGCTGCTCTTTTGTCGGAAGG - Intergenic
1006580790 6:35076576-35076598 CAGCTTCCTCAGTTGTAGGGTGG + Intronic
1007230915 6:40347287-40347309 CAGGGCCCTCTGCTCTAGGCAGG + Intergenic
1008043908 6:46832347-46832369 CAGGATCCTATGTTCTAGAACGG + Intronic
1009399705 6:63239808-63239830 CAGGGTCATCTGTTGGGGCAGGG + Intergenic
1012517213 6:100076286-100076308 GAGGGTCTTCTGTTGTTAGAGGG - Intergenic
1013313766 6:108922077-108922099 CAGAGTACTCTGATGGAGGAAGG + Intronic
1015352668 6:132241194-132241216 CAGGGGCCTCAGTTGGAAGACGG + Intergenic
1017776551 6:157685370-157685392 CAGGGTTCTCTTTTGTAAGCTGG - Intergenic
1018368115 6:163142930-163142952 GAGTCTCCTCTGTTCTAGGACGG - Intronic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1020290600 7:6719699-6719721 CAGGATCCTCTGTTATTAGAGGG + Intergenic
1022155024 7:27652125-27652147 CAGGGTTCTCAGCTGTAAGATGG - Intronic
1022830190 7:34058041-34058063 CTGTGCCCTCTCTTGTAGGATGG + Exonic
1024638133 7:51307402-51307424 CAGGGCCCTCTGATGTTGGTAGG - Intronic
1025242343 7:57287708-57287730 CAAAGTCCTCTGTGGTAGGAAGG - Intergenic
1025261188 7:57418133-57418155 CAGGGCCCTCTGTTGTAGGCTGG + Intergenic
1025640704 7:63365382-63365404 CAGGGTCCTCTGTTGTAGGGAGG + Intergenic
1025641995 7:63382704-63382726 CAGGGTCCTCTGTTGTAGGGAGG - Intergenic
1025716186 7:63958299-63958321 CATGATCTTCTGTTGTAAGATGG + Intergenic
1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG + Intronic
1027803860 7:82790561-82790583 TAAGGTACTCTGCTGTAGGAAGG - Intronic
1028311625 7:89345091-89345113 CTGAGTTCTCTGTTTTAGGAAGG + Intergenic
1029306737 7:99625160-99625182 CAGTTTCCTCTGTTGTGGAATGG + Intronic
1031403223 7:121351172-121351194 CTGGGTCTTCTGTGGTGGGAAGG - Exonic
1032488185 7:132304264-132304286 CTGTGTCCTCTGTAGTAGGGAGG + Intronic
1034470812 7:151253428-151253450 CAGGGTCCTGTGTGGCAGGCAGG + Intronic
1035738600 8:1908108-1908130 CAGAGTGCTCTGGTGTAAGAAGG + Intronic
1036719378 8:11158926-11158948 GCGGGTCCTCAGTTGCAGGAAGG - Intronic
1038421580 8:27437281-27437303 CAGGGACCCATGTTGGAGGAGGG + Intronic
1046701350 8:117404386-117404408 CAGTTTTCTCTTTTGTAGGAAGG + Intergenic
1047196267 8:122724748-122724770 CAGGTTCCTCTCTTGTAAAATGG - Intergenic
1048424112 8:134306598-134306620 CAGTATCCTCACTTGTAGGAAGG + Intergenic
1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG + Exonic
1052255914 9:26456327-26456349 CAGGGTCCTCATTTGTGAGATGG + Intergenic
1053801324 9:41766232-41766254 CAGGGTCTTCTGTAGTGGGGTGG + Intergenic
1054143876 9:61548591-61548613 CAGGGTCTTCTGTGGTGGGGTGG - Intergenic
1054189754 9:61978386-61978408 CAGGGTCTTCTGTAGTGGGGTGG + Intergenic
1054463654 9:65479930-65479952 CAGGGTCTTCTGTGGTGGGGTGG - Intergenic
1054843347 9:69766553-69766575 CCTGGGCCTCTGTGGTAGGAAGG - Intergenic
1056097229 9:83267407-83267429 CAGGGTCCTCTGTTTTGGTCCGG - Intronic
1056750273 9:89345599-89345621 GATCTTCCTCTGTTGTAGGAAGG + Intronic
1057785471 9:98084218-98084240 CAGGTTCCTGTGCTGTACGAGGG + Intronic
1057785865 9:98087106-98087128 CAGGTTCCTGTGCTGTACGAGGG + Exonic
1058686362 9:107484339-107484361 TAGGGTTGTCTGCTGTAGGAAGG + Intergenic
1059650702 9:116313376-116313398 CAGGGGCCTCTCTTCCAGGAAGG - Intronic
1059917629 9:119121300-119121322 CAAGGTGCTCTGCTGTAGCAGGG - Intergenic
1059932487 9:119274613-119274635 CAGGGTCCTTATTTGTAGAATGG + Intronic
1060569545 9:124625849-124625871 GAGAGTTCTCTCTTGTAGGAGGG - Intronic
1062060744 9:134494012-134494034 CATGGGCCTCTGTTCTCGGAGGG - Intergenic
1062181990 9:135195804-135195826 CAGGGCCCTCTTCTGTGGGAAGG - Intergenic
1062365657 9:136207808-136207830 CAGGCCCCTCTGTTGGGGGATGG - Exonic
1062447860 9:136603229-136603251 CAGTTTCCTCTGGTGTAAGACGG - Intergenic
1062637533 9:137499523-137499545 CAGGGTCCCCTGCTGGTGGAGGG + Intronic
1203563146 Un_KI270744v1:74239-74261 CAGGGGCCTGTGCTGTAGGAAGG + Intergenic
1186430154 X:9498293-9498315 CAGCGTCCTCTGTTTTCAGATGG + Intronic
1186858585 X:13649157-13649179 CAGGTGCCCCTGTTGTAGAATGG + Intergenic
1187802206 X:23076300-23076322 CTGGGTCTTCTGTGGTGGGAAGG + Intergenic
1196311318 X:114169708-114169730 CAGATACCTCTATTGTAGGATGG - Intergenic
1200846326 Y:7834979-7835001 CAGGCTCCTCTGTTGCAGGCAGG - Intergenic
1201160285 Y:11160255-11160277 CAGGGGCCTGTGCTGTAGGAAGG - Intergenic