ID: 1025739456

View in Genome Browser
Species Human (GRCh38)
Location 7:64183651-64183673
Sequence CAGGCTCACAGGTTGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 2, 2: 3, 3: 15, 4: 191}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025739456_1025739469 11 Left 1025739456 7:64183651-64183673 CCACAAAACAACCTGTGAGCCTG 0: 1
1: 2
2: 3
3: 15
4: 191
Right 1025739469 7:64183685-64183707 GGGCCCTGTCCCCAGGAGGGGGG 0: 1
1: 0
2: 5
3: 61
4: 537
1025739456_1025739468 10 Left 1025739456 7:64183651-64183673 CCACAAAACAACCTGTGAGCCTG 0: 1
1: 2
2: 3
3: 15
4: 191
Right 1025739468 7:64183684-64183706 AGGGCCCTGTCCCCAGGAGGGGG 0: 1
1: 0
2: 6
3: 53
4: 441
1025739456_1025739466 8 Left 1025739456 7:64183651-64183673 CCACAAAACAACCTGTGAGCCTG 0: 1
1: 2
2: 3
3: 15
4: 191
Right 1025739466 7:64183682-64183704 GGAGGGCCCTGTCCCCAGGAGGG No data
1025739456_1025739465 7 Left 1025739456 7:64183651-64183673 CCACAAAACAACCTGTGAGCCTG 0: 1
1: 2
2: 3
3: 15
4: 191
Right 1025739465 7:64183681-64183703 CGGAGGGCCCTGTCCCCAGGAGG No data
1025739456_1025739459 -10 Left 1025739456 7:64183651-64183673 CCACAAAACAACCTGTGAGCCTG 0: 1
1: 2
2: 3
3: 15
4: 191
Right 1025739459 7:64183664-64183686 TGTGAGCCTGACTCCCTCGGAGG 0: 1
1: 0
2: 0
3: 11
4: 90
1025739456_1025739460 -9 Left 1025739456 7:64183651-64183673 CCACAAAACAACCTGTGAGCCTG 0: 1
1: 2
2: 3
3: 15
4: 191
Right 1025739460 7:64183665-64183687 GTGAGCCTGACTCCCTCGGAGGG No data
1025739456_1025739475 21 Left 1025739456 7:64183651-64183673 CCACAAAACAACCTGTGAGCCTG 0: 1
1: 2
2: 3
3: 15
4: 191
Right 1025739475 7:64183695-64183717 CCCAGGAGGGGGGTCAGCCTGGG No data
1025739456_1025739473 20 Left 1025739456 7:64183651-64183673 CCACAAAACAACCTGTGAGCCTG 0: 1
1: 2
2: 3
3: 15
4: 191
Right 1025739473 7:64183694-64183716 CCCCAGGAGGGGGGTCAGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 359
1025739456_1025739464 4 Left 1025739456 7:64183651-64183673 CCACAAAACAACCTGTGAGCCTG 0: 1
1: 2
2: 3
3: 15
4: 191
Right 1025739464 7:64183678-64183700 CCTCGGAGGGCCCTGTCCCCAGG 0: 1
1: 0
2: 1
3: 18
4: 236
1025739456_1025739467 9 Left 1025739456 7:64183651-64183673 CCACAAAACAACCTGTGAGCCTG 0: 1
1: 2
2: 3
3: 15
4: 191
Right 1025739467 7:64183683-64183705 GAGGGCCCTGTCCCCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025739456 Original CRISPR CAGGCTCACAGGTTGTTTTG TGG (reversed) Intronic
900896173 1:5484446-5484468 CAGGCTCCCAGGATGCTCTGTGG - Intergenic
903325939 1:22568565-22568587 CCGCCTCTCAGGTTGTTGTGCGG + Intronic
903738885 1:25546628-25546650 CAGGCCCTCCGGTTATTTTGTGG + Intronic
903834531 1:26194562-26194584 TAGGCTCACAGACTATTTTGAGG - Intronic
903891411 1:26572805-26572827 CTGCCTCACAGGTTGATGTGAGG - Intronic
905116480 1:35645674-35645696 TAAGCTCACAGGGTCTTTTGAGG - Intergenic
905847982 1:41249611-41249633 TAGCGTCACAGGTTGTTTTAAGG + Intergenic
907619539 1:55962398-55962420 CAGGCTTACTGGTTGTTTGGTGG - Intergenic
910164950 1:84317083-84317105 CATTCTCACAGGTTTTTTTGTGG + Intronic
911100070 1:94088548-94088570 CAGGCACAGAAGTTGGTTTGGGG - Intronic
914423051 1:147547016-147547038 TGTGCTCACATGTTGTTTTGAGG + Intronic
915613496 1:157015350-157015372 GACGCTCACAGGCTGTTATGAGG + Intronic
915972768 1:160366180-160366202 CAGGCTCTGAGTGTGTTTTGAGG - Intergenic
916195009 1:162214387-162214409 CAGGCTCACAGTCTGGTTGGAGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919286332 1:195566139-195566161 CAAGATCACAGTTTATTTTGGGG - Intergenic
922776366 1:228215923-228215945 CAGGCTGACAGGGTGTCCTGGGG - Intronic
923914396 1:238485885-238485907 TAGGCTCACAGGCTGTTTGAAGG + Intergenic
1064899187 10:20275295-20275317 CAGGCTCCCAGGTGATGTTGAGG - Intronic
1065757705 10:28949137-28949159 TGGCCTCACGGGTTGTTTTGGGG - Intergenic
1067067915 10:43113906-43113928 CAGGCTGACAAGTTGTTTGGTGG - Intronic
1067751237 10:48973073-48973095 CAGGCACACAGGCTGTTTCCTGG + Intronic
1072779001 10:98231099-98231121 CAGGCTCATAGTTTCTTTTCTGG - Intronic
1073457355 10:103645696-103645718 CAGCCCCACAGGTTGTTTGCAGG + Intronic
1073492055 10:103859228-103859250 CAAGGTCACAGGCTGGTTTGTGG - Intergenic
1073981633 10:109160644-109160666 CAGGCTCCCAGGTGATTCTGGGG - Intergenic
1074566901 10:114587924-114587946 CCAGCTCACAGGTTCTTTAGGGG + Intronic
1074629580 10:115236874-115236896 GAGGATCACAGGTTATTTTTAGG - Intronic
1075447283 10:122521900-122521922 CAAGCTCAGTGGTTGATTTGTGG + Intergenic
1076262456 10:129078544-129078566 CTGGCTCAAAGGCTGTATTGTGG - Intergenic
1076388727 10:130079700-130079722 CATGCTCACAAGTAGTTTGGTGG + Intergenic
1078077397 11:8174377-8174399 CAGTCTCAAAGGATGCTTTGGGG - Intergenic
1078690006 11:13570228-13570250 CAGCCTCACAGGTTGATCTCAGG - Intergenic
1078947851 11:16091256-16091278 CTGACTCAAAGCTTGTTTTGAGG - Intronic
1079326490 11:19497221-19497243 CTGCCTCACAGGTTGTTATGAGG + Intronic
1079624409 11:22598592-22598614 CAGGGTCACAGGTAGTCCTGGGG - Intergenic
1080028873 11:27639922-27639944 CAGGCTCACCAGTTGTTTGTTGG + Intergenic
1080759541 11:35235197-35235219 CATGCTCACAGGTCCTCTTGAGG + Intergenic
1081642496 11:44765914-44765936 CCTACTCACAGGTTGCTTTGGGG + Intronic
1083057961 11:59841433-59841455 CTGTTTCACAGGTTGTTCTGAGG - Intronic
1086961465 11:92983110-92983132 CAGCCTCCCAGGTTGTTGTGAGG + Intronic
1087777542 11:102270010-102270032 CAGGCTCGCAGGCTGGTTTGGGG + Intergenic
1088906732 11:114160827-114160849 CATTCTCAGAGGTGGTTTTGGGG + Intronic
1090346213 11:126073301-126073323 TAGGTTGCCAGGTTGTTTTGAGG + Intergenic
1090963282 11:131575854-131575876 CAGGCTCACTGGGTGCTCTGTGG + Intronic
1091179556 11:133591396-133591418 CAGGGTCCAGGGTTGTTTTGTGG - Intergenic
1092573058 12:9746455-9746477 TAGGTTGACTGGTTGTTTTGGGG - Intergenic
1094495128 12:30984497-30984519 CTGGGTCTCAGGTTGTTGTGTGG - Intronic
1095787296 12:46123673-46123695 CTATCTCATAGGTTGTTTTGAGG - Intergenic
1100328831 12:93567095-93567117 CAGGATCACAGGGAGTCTTGAGG + Intergenic
1101882786 12:108637373-108637395 CAGGCTCACACGGTGTTGCGAGG - Intergenic
1102398631 12:112609732-112609754 CAAGATGACAGGTTGGTTTGGGG - Intronic
1102653509 12:114460850-114460872 TAACCTCACAGGTTGTTATGGGG + Intergenic
1104769646 12:131353278-131353300 CAGGCCTGCAGGTTGTTGTGAGG - Intergenic
1106232943 13:27835923-27835945 CAGACTCACAGGCAGTTGTGAGG + Intergenic
1106617180 13:31340454-31340476 CAGGCTCACAGATGGTTTGAAGG - Intergenic
1108336773 13:49451226-49451248 CTATCTCACAGGTTGTTCTGAGG - Intronic
1109480794 13:62949614-62949636 CAGGTACAAAGGTTGTTATGGGG + Intergenic
1109809778 13:67497064-67497086 CAGGATCAGTGGTGGTTTTGGGG - Intergenic
1113137018 13:107102269-107102291 CAGCCTAAAAGGTTGTTATGTGG - Intergenic
1113175710 13:107561256-107561278 CAGGCTCACATGTTGTACTTAGG + Intronic
1114593901 14:23894713-23894735 CAGCCTCTCAGGTGGTTCTGAGG + Intergenic
1115331220 14:32201156-32201178 CAGGCTGAGAGGTGGATTTGAGG - Intergenic
1115647052 14:35375928-35375950 CAGGCTCACAGGGCCTTTTTGGG - Intergenic
1117006583 14:51426823-51426845 CTGGCTCGCAGGCTGTTGTGAGG + Intergenic
1120185794 14:81392436-81392458 CAGGCTCACAGATGGTTTGAAGG - Intronic
1121067248 14:90979756-90979778 CAGCTTCACTGGCTGTTTTGAGG - Intronic
1122482109 14:102054082-102054104 CGGGCTCTCAGGCTGTTTTTGGG - Intergenic
1122724860 14:103743753-103743775 CTGGCTCAGACGTTGTTGTGAGG - Intronic
1123439757 15:20281874-20281896 CAGGCTCCCAGCTTGATATGGGG - Intergenic
1123891226 15:24781671-24781693 CAAGCTCACAGATTGTTGTTAGG - Intergenic
1125677248 15:41509001-41509023 CAGGCTCAGAGGTGGGGTTGGGG + Intronic
1125684759 15:41557887-41557909 CAGGCTCACTGGATCTTTTCAGG - Intronic
1128292964 15:66492818-66492840 CAGTTTCACAGGTTGCTATGAGG - Intronic
1128335582 15:66783851-66783873 CAGGCTCACAGGCAGTTTGTGGG + Intergenic
1129171061 15:73808267-73808289 CTGACCCACAGGTTGTTTTGAGG + Intergenic
1130873327 15:87990206-87990228 CAGGCTCACAGGTTCCTATTAGG + Intronic
1132879720 16:2156709-2156731 CAGGCTCACAGGGTGCATGGTGG + Intronic
1134014105 16:10876821-10876843 GAGGCTCTCAGCTTGTCTTGAGG + Intergenic
1135681482 16:24460962-24460984 CAGGCTGTCTGGTTGTTTTGGGG - Intergenic
1136845410 16:33572524-33572546 CAGGCTCCCAGCTTGATATGGGG + Intergenic
1137492302 16:48943443-48943465 CAAGCTCCCAGGTTGTTTTCTGG + Intergenic
1139202588 16:64993736-64993758 CAGGAACAAAGGTTGTTTTTAGG - Intronic
1139681855 16:68571177-68571199 CAGCATCAAGGGTTGTTTTGAGG + Intronic
1141875291 16:86819915-86819937 CAGCCTCACAGATTATTTGGAGG - Intergenic
1203107118 16_KI270728v1_random:1421177-1421199 CAGGCTCCCAGCTTGATATGGGG + Intergenic
1143685047 17:8507051-8507073 AAGGCATACAGGTTGTTGTGAGG - Intronic
1144784592 17:17824522-17824544 CAGGCTCTAGGGTTCTTTTGAGG + Intronic
1145981400 17:29014258-29014280 CTAGCTCATAGGTTGTTGTGAGG - Intronic
1146059753 17:29598205-29598227 CAGGCCCGCTGGTTTTTTTGAGG + Intronic
1146470672 17:33121867-33121889 GAGGCTGACAGGTTCTCTTGGGG - Intronic
1149655422 17:58307355-58307377 CTACCTCACAGGGTGTTTTGTGG - Intronic
1149928973 17:60730876-60730898 TTGGCTTACAGGGTGTTTTGAGG + Intronic
1150947210 17:69761021-69761043 AAGCCTCACAGGTTATGTTGGGG - Intergenic
1153967224 18:10192757-10192779 CTGCCTCACAGGTTGCTGTGAGG + Intergenic
1156497820 18:37537597-37537619 CAGGCTCACATGTGGAGTTGGGG - Intronic
1157181140 18:45499141-45499163 CAGACTCACTGGTTGTTTTGGGG + Intronic
1157342417 18:46791192-46791214 TTGCCTTACAGGTTGTTTTGAGG + Intergenic
1160910575 19:1472037-1472059 AAGGCTGTCAGGTTGTTTTGGGG + Exonic
1161968497 19:7561985-7562007 CGGGCTCACAGGTGCTCTTGGGG + Intergenic
1162558393 19:11401870-11401892 CAAGGTCACAGGTTGTAGTGGGG + Intronic
1166709059 19:44925571-44925593 CAGGCTGACACGTGGTTGTGGGG + Intergenic
1168651475 19:58095278-58095300 GGAGCTCACAGTTTGTTTTGTGG - Intronic
926373233 2:12201689-12201711 CAGGCTCACAGCATTTTTTAAGG + Intergenic
927692691 2:25219481-25219503 CTGCCTCACAGGTTGTGCTGAGG - Intergenic
928133658 2:28671955-28671977 CACCCTCACAGTTTGTTATGTGG - Intergenic
929266489 2:39924331-39924353 CAGGCTCACAAGTTCCTTGGAGG - Intergenic
931657915 2:64526845-64526867 CTGCCTTACAGGTTGTTGTGTGG - Intronic
931869199 2:66440979-66441001 CAGGCAAACTGGTTGTTTGGGGG - Intronic
933142581 2:78812491-78812513 CATGATCAAAGGTTGTATTGTGG - Intergenic
937796776 2:126032384-126032406 CAGGCTCCCAGGTTGGATAGAGG + Intergenic
938606858 2:132903072-132903094 CTGGATCACAGGTTGTTGTGAGG + Intronic
941109004 2:161396793-161396815 CAGGATAAGAGGTTTTTTTGAGG + Intronic
942186661 2:173430712-173430734 CATGCTGACAGATTGTTTTCTGG + Intergenic
942459674 2:176160344-176160366 CAGGGTCAGAGGTCGTTGTGGGG + Intronic
943247575 2:185474354-185474376 CAGGCACACAGGCTGCTGTGTGG - Intergenic
944487863 2:200225539-200225561 GAGGGTCACAGATTGTTTGGTGG + Intergenic
945423862 2:209674404-209674426 CTGTCTCAGAGGTTGTTGTGGGG - Intronic
945725011 2:213464753-213464775 CTGGCTCAAAGGTTGTTGTCAGG - Intronic
946243955 2:218374838-218374860 CTGGCCCACAGGTGTTTTTGGGG + Intergenic
1168836298 20:879942-879964 CAGGCTCACCTGTTGCTCTGTGG - Intronic
1170114295 20:12839816-12839838 CCAGCTCACAGGTTGCTATGAGG + Intergenic
1171039303 20:21745135-21745157 AAGACTCACTGGTTATTTTGAGG + Intergenic
1173260230 20:41428051-41428073 CAGGCTCCCAGCTTGGTGTGAGG + Intronic
1174189667 20:48731330-48731352 AAGGGTGACAGGATGTTTTGAGG - Intronic
1175867040 20:62184390-62184412 CATGCTCACAGGAGGATTTGAGG + Intronic
1178264688 21:31132163-31132185 CAGGCTCACAGGCCCTTTGGAGG + Intronic
1180857577 22:19058151-19058173 CAGACTCACTGGCTTTTTTGAGG - Intronic
1181635285 22:24171605-24171627 CAGGCGCACAGGATGTCCTGTGG + Intronic
1181767743 22:25103862-25103884 CACGCTCAAGTGTTGTTTTGAGG + Intronic
1182722629 22:32415617-32415639 CAGCCTTACAGATTGTCTTGTGG + Intronic
1183984739 22:41563177-41563199 CAGGCACACAGGCTGTGTGGGGG + Intronic
949578752 3:5365082-5365104 CATGATCACAAGTTGGTTTGAGG - Intergenic
953381749 3:42477544-42477566 CAGGTCCACAGGTTGTTTGAGGG - Intergenic
956082341 3:65570846-65570868 CAGGCTGCCTGGTTGTTTGGGGG + Intronic
956256818 3:67292050-67292072 CAAGCTCATGGGTTGTTGTGAGG - Intergenic
956310699 3:67876268-67876290 CAGCTTCCCAGTTTGTTTTGGGG + Intergenic
957574004 3:81986260-81986282 CAGGCTCACAGATGGTTTGAAGG - Intergenic
961902891 3:130231498-130231520 CAGGCTCACAGGTTGTATCTGGG + Intergenic
962015746 3:131438633-131438655 CAGGCCCACAGCCTGGTTTGTGG - Intergenic
962069020 3:132013736-132013758 CCAGCTCATAGGTTGTTGTGAGG - Intronic
962449015 3:135495967-135495989 CTGGCTCAGGGGCTGTTTTGTGG - Intergenic
967439216 3:189487762-189487784 CAGCTTCAAAGGTTGTTATGAGG - Intergenic
967732577 3:192919295-192919317 CTGTCTCACAGGTTGTTTTAAGG + Intergenic
967842980 3:194021720-194021742 CAGGCTCTCAGGTTGATTACTGG + Intergenic
968332362 3:197882076-197882098 CAGGCTCTCATGTGGTTTAGGGG + Intronic
971954134 4:33394175-33394197 CAGGCTCAGATGTCTTTTTGAGG - Intergenic
972332876 4:38080058-38080080 CAAGCTCCCAGGTGGTGTTGAGG + Intronic
973638913 4:52884644-52884666 CTGGCTCAGGGGCTGTTTTGGGG + Intronic
974939158 4:68442939-68442961 CAGCCTCACAGTTTGTGTTGAGG + Intergenic
975090610 4:70398547-70398569 TAGGCTGACAGATTGTCTTGGGG - Intronic
976518963 4:86004400-86004422 CACACACACAGGGTGTTTTGTGG + Intergenic
981102244 4:140841952-140841974 CTGCCTCATAGGTTGTTATGGGG + Intergenic
982868315 4:160545471-160545493 CAGTCTCCCAGGTAATTTTGAGG + Intergenic
982963020 4:161864406-161864428 TAACCTCACAGGTTGTTGTGAGG + Intronic
983286122 4:165741848-165741870 CTGGTTCATAGGGTGTTTTGGGG - Intergenic
983515636 4:168653625-168653647 CATACTCAAAGGTTGTCTTGTGG - Intronic
983657931 4:170101594-170101616 CAGGGTAACAGGTTCTTTTCTGG - Intergenic
984783094 4:183543714-183543736 AAGGCTAACAAGGTGTTTTGAGG + Intergenic
984799387 4:183699654-183699676 CAGGCTGACACCTTGTTTTTTGG - Intronic
988851550 5:35185967-35185989 AAGGCTCAGTGGGTGTTTTGAGG - Intronic
990867464 5:60396033-60396055 CAGCCTCCTTGGTTGTTTTGTGG + Intronic
991096414 5:62744654-62744676 CATTCTCACAAGTTGTTGTGAGG - Intergenic
991311109 5:65243236-65243258 CACACTCAGAGATTGTTTTGAGG + Intronic
992229120 5:74646110-74646132 CTGGCTGGAAGGTTGTTTTGTGG + Intronic
993996100 5:94724918-94724940 CAGCCTCACAGCTTCTGTTGTGG - Intronic
996533577 5:124552001-124552023 CTGTCTCATAGGTTGTTCTGAGG - Intergenic
996559185 5:124810295-124810317 CAGAGTCACAGGTTATTTTCAGG - Intergenic
997710672 5:136001454-136001476 CAGGCCCACAGGTTCTGGTGTGG + Intergenic
1000821686 5:165992499-165992521 AATACTCACAGGCTGTTTTGAGG + Intergenic
1001636320 5:173213066-173213088 CTGCCTCATAGGGTGTTTTGTGG + Intergenic
1002042819 5:176527364-176527386 CAGGCTCACAGATTGTGTGTCGG - Exonic
1007702670 6:43773747-43773769 CATGCCCACAGGTTGCTTAGAGG - Intronic
1010264139 6:73849093-73849115 TTTGCTCTCAGGTTGTTTTGTGG + Intergenic
1015691780 6:135932641-135932663 CTGCCTCACAGGTTGTCCTGGGG - Intronic
1015693080 6:135947622-135947644 GAGGCTGATAGGTTCTTTTGTGG + Intronic
1018529091 6:164743851-164743873 CAGGACTACAGGTTGTTTTAGGG + Intergenic
1019013585 6:168862934-168862956 CTGGCTTAAAGGGTGTTTTGAGG - Intergenic
1021748220 7:23765914-23765936 TAGGTTCACTGGTTGGTTTGGGG - Intronic
1022108256 7:27212308-27212330 CAACCTCACAGGTTGTTAGGAGG - Intergenic
1023479901 7:40622835-40622857 CAGGCTCAGAACCTGTTTTGGGG - Intronic
1025262119 7:57426433-57426455 CAGGTTCACAGGTTGTTTTGTGG - Intergenic
1025615338 7:63112893-63112915 CAGGCTCACACACTGTTGTGTGG + Intergenic
1025681306 7:63683795-63683817 CAGCATCACAGCCTGTTTTGGGG - Intergenic
1025739456 7:64183651-64183673 CAGGCTCACAGGTTGTTTTGTGG - Intronic
1026000817 7:66558095-66558117 CAGGCTCACAGGTTGTTCTGTGG - Intergenic
1028399575 7:90410080-90410102 CAGGCACACAAGTTGTATGGGGG + Intronic
1029957121 7:104651874-104651896 CAGGCTCACAGGCTATTGTGAGG + Intronic
1032127790 7:129207139-129207161 CAGCCTCACAGCTTGTTAGGTGG + Intronic
1035867550 8:3101205-3101227 CTTGCTCTCAGGGTGTTTTGGGG - Intronic
1036509200 8:9384776-9384798 CAGCTTCACAGGTTATTCTGAGG + Intergenic
1036778935 8:11632535-11632557 CAAACTCACAGCTGGTTTTGGGG - Intergenic
1037914354 8:22763603-22763625 CTGCCTCACAGGGTGTTGTGAGG + Intronic
1038114381 8:24536655-24536677 CAAGTTCACAGGTTCATTTGAGG + Intergenic
1039437050 8:37566915-37566937 CAGCCTCAGGCGTTGTTTTGGGG - Intergenic
1039911905 8:41832986-41833008 CAGCACCCCAGGTTGTTTTGGGG - Intronic
1039915676 8:41858758-41858780 CAGCTTCACAGTTTGTTGTGTGG + Intronic
1042864978 8:73349190-73349212 CCAGCTCACAGGTTGTCATGAGG - Intergenic
1043932662 8:86108454-86108476 TACGCTTTCAGGTTGTTTTGGGG - Intronic
1051910893 9:22153991-22154013 CAGACTCACAGGTTGTTGTGTGG - Intergenic
1052395707 9:27935518-27935540 CAGGATCACATGTCTTTTTGTGG + Intergenic
1052402276 9:28015748-28015770 CTGAGTCTCAGGTTGTTTTGAGG - Intronic
1053421773 9:37984297-37984319 CAGGCTCAAAGGTTGGTATTGGG - Intronic
1055035382 9:71812733-71812755 CATGCTCCCAGCCTGTTTTGAGG + Intronic
1056138002 9:83647959-83647981 CAGGTACACAGTTTCTTTTGCGG + Intergenic
1056424312 9:86461447-86461469 CTGCCTCACGGGTTGTTGTGAGG + Intergenic
1058852912 9:109030046-109030068 CAGTATCACCGTTTGTTTTGGGG + Intronic
1059726197 9:117010692-117010714 CAGGCATTCAGGATGTTTTGGGG + Intronic
1060865144 9:126989464-126989486 CAGGCCCACAGCTTGTCTTCAGG - Intronic
1061987831 9:134140385-134140407 CAGGATCACAGGTGGGATTGAGG + Intronic
1062545976 9:137063920-137063942 CAGGCTCACAGGATGTTGTGTGG + Exonic
1188903875 X:35767879-35767901 CAGGCTCACAATTTATTTTTGGG + Intergenic