ID: 1025744325

View in Genome Browser
Species Human (GRCh38)
Location 7:64229699-64229721
Sequence TACTCCCCTGGCTAGATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025744325_1025744329 0 Left 1025744325 7:64229699-64229721 CCCTAAATCTAGCCAGGGGAGTA 0: 1
1: 0
2: 2
3: 8
4: 72
Right 1025744329 7:64229722-64229744 AAAAATCTGTTGTATTTGCTGGG No data
1025744325_1025744328 -1 Left 1025744325 7:64229699-64229721 CCCTAAATCTAGCCAGGGGAGTA 0: 1
1: 0
2: 2
3: 8
4: 72
Right 1025744328 7:64229721-64229743 AAAAAATCTGTTGTATTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025744325 Original CRISPR TACTCCCCTGGCTAGATTTA GGG (reversed) Intronic
901040272 1:6359276-6359298 TCCTCCCCTGTCTACATTTCAGG - Intronic
903989241 1:27254019-27254041 TATGCCCCTTGGTAGATTTAAGG + Intronic
908050306 1:60222391-60222413 TAAACCAATGGCTAGATTTATGG + Intergenic
910766618 1:90788868-90788890 TGCTCCCTTTGTTAGATTTATGG + Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
921457767 1:215392953-215392975 TACTCTCCAAACTAGATTTATGG - Intergenic
924672861 1:246147321-246147343 TGCTCCCCTGGCTGGACCTATGG - Intronic
924815610 1:247439056-247439078 TACTCCCTTGGATGGATTGATGG - Intronic
1064923614 10:20545794-20545816 GACTCCCCAGGCTAGGCTTATGG + Intergenic
1068261202 10:54584522-54584544 TATTACCCTGGATAGATTTAGGG - Intronic
1074463407 10:113659600-113659622 TACCCCACTGGTAAGATTTATGG - Intronic
1077997208 11:7464304-7464326 AGCTCATCTGGCTAGATTTAGGG + Intronic
1079282997 11:19104697-19104719 TACTACCCTGGCTAGCTCTCTGG + Intergenic
1084939642 11:72605693-72605715 TCCTCCCCTGGCTGGGGTTATGG - Intronic
1089117209 11:116105189-116105211 TAGTACCATGGCTAAATTTAAGG + Intergenic
1089202705 11:116734032-116734054 TTCTCCCCCGGCCAGACTTAGGG - Intergenic
1090578820 11:128137882-128137904 TACTGCCCTGGAGAGAGTTAGGG - Intergenic
1095912419 12:47442178-47442200 TACCCATCTGGCTAGATTCATGG + Intergenic
1103906519 12:124330423-124330445 CAGTTCCCTGGCTGGATTTAAGG + Intronic
1106793141 13:33177117-33177139 TAATTCCCTGGCTAGCTTTGAGG + Intronic
1111089935 13:83431773-83431795 TCCTCCCCTGGATGGCTTTAAGG - Intergenic
1114010212 14:18358414-18358436 TACACCCCTGAGCAGATTTATGG + Intergenic
1127779078 15:62295639-62295661 AAATCACATGGCTAGATTTAAGG - Intergenic
1133892212 16:9891093-9891115 TCTTCCCCTTTCTAGATTTATGG - Exonic
1163096208 19:15059157-15059179 TACTGCCATGGCTAGATTCCTGG - Intergenic
1164129857 19:22351551-22351573 GACTCTCATGGCTAGAATTAGGG + Intergenic
1164169691 19:22714458-22714480 GACTCTCATGGCTAGAATTAGGG - Intergenic
1165077860 19:33290801-33290823 CACTCCCCTGGGTGGATTTGGGG + Intergenic
1165228537 19:34371157-34371179 TACTCCAGTGGCCAGCTTTAAGG - Intronic
925003316 2:423385-423407 TACTCACGTGTTTAGATTTAAGG - Intergenic
934923639 2:98366479-98366501 CTCTCCCCTGGCTGGCTTTAAGG - Intronic
941102309 2:161309732-161309754 TCTTCCCTTGGCAAGATTTAGGG - Intronic
945154408 2:206823469-206823491 TGCTCCCCTGCCTAGTTTTCTGG - Intergenic
1172269712 20:33647612-33647634 AGCTACCCTGGCTAGTTTTATGG - Exonic
1174222426 20:48967553-48967575 TGTTCCCCTGGCTAGACTTCTGG - Intronic
1177852273 21:26362838-26362860 TAGTTCCCTGGGTAGATTTAAGG + Intergenic
1180434710 22:15289215-15289237 TACACCCCTGAGCAGATTTATGG + Intergenic
949317958 3:2777587-2777609 TACTCTCCTGGCTACTTTTAAGG - Intronic
953655200 3:44845963-44845985 AACTCCCCTGGATACATTAATGG + Intronic
954438664 3:50509616-50509638 TACTCCCCTGGGCAGATGTTTGG - Intergenic
954754312 3:52830982-52831004 TTCTCCCCGGGCTGGACTTAGGG - Intronic
954754379 3:52831254-52831276 TAAAGCCCTGGCTAGATTAATGG - Intronic
956869637 3:73404145-73404167 TACTCCTCTGGCAAGAGATAGGG + Exonic
957697087 3:83653005-83653027 TACTGCCCTGCCTAGATTTTAGG - Intergenic
961241495 3:125415730-125415752 AACTCCTCTGGCTAGATTTAGGG + Intergenic
965063520 3:163813278-163813300 TTCTCAGCTGGCTACATTTAAGG + Intergenic
968937316 4:3617883-3617905 TCCTCAACTGGCTAAATTTAGGG - Intergenic
971673035 4:29589094-29589116 TAATCCTCTGCTTAGATTTATGG + Intergenic
971673104 4:29590158-29590180 TAATCCTCTGCTTAGATTTATGG - Intergenic
971842954 4:31878123-31878145 TACTACCCTGGAAAGATTTCTGG - Intergenic
974286307 4:59872161-59872183 TACTCCAATGTCTAGATTGAAGG + Intergenic
977684434 4:99832112-99832134 TATTCTCCTGACTAGATTAATGG + Intronic
979345817 4:119585558-119585580 TTATCCTCTGGCTAGTTTTAAGG + Intronic
984097251 4:175448371-175448393 CAATCCCCTGGTTACATTTAGGG - Intergenic
986420992 5:7581915-7581937 TATTCACATGGTTAGATTTAGGG - Intronic
992683059 5:79172198-79172220 TACTCTACTGGCTAGAATTCAGG - Intronic
994138662 5:96318198-96318220 TGCTCCCCTGGCTGGATTGCTGG + Intergenic
1004201582 6:13553935-13553957 TACTACCCTGAATACATTTAGGG + Intergenic
1008340882 6:50362566-50362588 TTCTCCCTTAGCTAGATTTATGG - Intergenic
1008552957 6:52650730-52650752 TACTCCCCGGCCTAGATTTAAGG + Intergenic
1011738206 6:90333667-90333689 CACTCCCCTGGCTGCTTTTATGG + Intergenic
1012109830 6:95215325-95215347 TTCTCGCCTGGCTAAAATTAAGG - Intergenic
1016143149 6:140638288-140638310 TACTGCTTTGGTTAGATTTAAGG - Intergenic
1023362088 7:39427333-39427355 TTCCCCACTGGCTGGATTTAAGG - Intronic
1025744325 7:64229699-64229721 TACTCCCCTGGCTAGATTTAGGG - Intronic
1025751553 7:64298236-64298258 TACTCTTCTGGCTAGACTTAGGG - Intergenic
1025761501 7:64400158-64400180 TACTCTCATGACTAGGTTTAGGG + Intergenic
1037243866 8:16808281-16808303 TACTCCCATGGCTACTTTTGTGG - Intergenic
1037336232 8:17794883-17794905 AGCTCCCTTGGCTAGCTTTACGG - Intronic
1039286984 8:36052459-36052481 TCCTCAACTGGCTAAATTTAGGG + Intergenic
1039967870 8:42296848-42296870 TACTCACCTTGTTAGAATTATGG + Intronic
1050495589 9:6238388-6238410 TACTCCCATGGCAAGACTGAGGG + Intronic
1058754504 9:108072104-108072126 TTCTCCCCTGGCTAGGTTTTGGG + Intergenic
1203777782 EBV:83337-83359 TACTCGCCAGCCTAGATTTGTGG + Intergenic
1185925244 X:4138927-4138949 TTCTCCCCATGCTAGATTTCAGG + Intergenic
1187012911 X:15298184-15298206 TACTCCCCAAGCCAGATTCAAGG - Intronic
1188088480 X:25932783-25932805 TACTTCCCTGGGTCGATTTTGGG - Intergenic
1188956020 X:36435842-36435864 AACTCCCTTGGCCAGATTTGGGG + Intergenic
1195620789 X:106952620-106952642 TCCTCCCCTTGCTAGATTTGTGG + Intronic
1196815049 X:119658334-119658356 TACTCACATGGCTAGATCTCAGG - Intronic
1200337344 X:155364144-155364166 TGCTCCCCTGGTTAGGGTTAGGG - Intergenic
1200349126 X:155477083-155477105 TGCTCCCCTGGTTAGGGTTAGGG + Intergenic