ID: 1025745745

View in Genome Browser
Species Human (GRCh38)
Location 7:64241314-64241336
Sequence CTGTCTCCACAATTGGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025745745_1025745750 -9 Left 1025745745 7:64241314-64241336 CCCAATCCCAATTGTGGAGACAG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1025745750 7:64241328-64241350 TGGAGACAGACCACGCACAAGGG 0: 1
1: 1
2: 0
3: 9
4: 135
1025745745_1025745753 5 Left 1025745745 7:64241314-64241336 CCCAATCCCAATTGTGGAGACAG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1025745753 7:64241342-64241364 GCACAAGGGTTGCATCACCTGGG No data
1025745745_1025745754 11 Left 1025745745 7:64241314-64241336 CCCAATCCCAATTGTGGAGACAG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1025745754 7:64241348-64241370 GGGTTGCATCACCTGGGTGCTGG 0: 2
1: 0
2: 9
3: 72
4: 709
1025745745_1025745749 -10 Left 1025745745 7:64241314-64241336 CCCAATCCCAATTGTGGAGACAG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1025745749 7:64241327-64241349 GTGGAGACAGACCACGCACAAGG 0: 1
1: 1
2: 0
3: 7
4: 138
1025745745_1025745752 4 Left 1025745745 7:64241314-64241336 CCCAATCCCAATTGTGGAGACAG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1025745752 7:64241341-64241363 CGCACAAGGGTTGCATCACCTGG 0: 1
1: 1
2: 1
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025745745 Original CRISPR CTGTCTCCACAATTGGGATT GGG (reversed) Intronic
902159733 1:14520299-14520321 CTGTCTCCTCCATTGGGCTGTGG - Intergenic
902892516 1:19454572-19454594 CGGTTTCCACAATTGTCATTTGG - Intronic
904956764 1:34291086-34291108 GTTTTTCCACAAGTGGGATTGGG + Intergenic
905437736 1:37969522-37969544 CTGTTTCCAAAATGGGGAATGGG + Intronic
906315173 1:44782295-44782317 CTGTCTCCACATTATAGATTTGG + Intergenic
907287321 1:53390236-53390258 CAGACTGCACAATTGGGATGTGG - Intergenic
908186695 1:61659102-61659124 CTGTCTCCACAATTCCTTTTTGG - Intergenic
908218643 1:61981096-61981118 CTGTCTCCACAGTCAGGCTTCGG - Intronic
908588747 1:65605154-65605176 CTGGCTACACAATGTGGATTAGG + Exonic
908647416 1:66293550-66293572 GTGTCTGCAAAATGGGGATTTGG + Intronic
909324346 1:74331171-74331193 TTGACTCTACAATTGGGTTTAGG + Intronic
910469792 1:87539689-87539711 ATGTCTGCACTATTGGGTTTTGG + Intergenic
911837995 1:102645612-102645634 GTGTCACCACAATTGGGACTGGG + Intergenic
911862721 1:102974025-102974047 CCCTCTCCAGAATTGTGATTTGG + Intronic
914417533 1:147497786-147497808 CAGGCTCCACAATTGGCCTTCGG + Intergenic
915013027 1:152707800-152707822 CTCTCTCCACAGTTAGGACTGGG + Intergenic
915814235 1:158949919-158949941 ATGTAGCCACAATTGGGTTTGGG + Intronic
916247234 1:162700702-162700724 CTTACTCTACTATTGGGATTTGG + Intronic
917064842 1:171080749-171080771 CTCTCCCCACAGTTGGGTTTTGG - Intergenic
918047415 1:180949746-180949768 ATGGCTCCTCAATTGGGATGGGG - Exonic
918533535 1:185549367-185549389 CTGTCTCCATAAATGGCACTTGG - Intergenic
922607931 1:226902474-226902496 CTTGCTCCCCATTTGGGATTTGG + Intronic
1067071842 10:43138296-43138318 CTGTCTCCACAAACGGTTTTTGG + Intergenic
1067218267 10:44321856-44321878 CTGTCACCACAAGTGAGATATGG + Intergenic
1070289217 10:75103883-75103905 CAGTCTCCACAGGTGGGAGTGGG - Intronic
1074936012 10:118182233-118182255 CTGACTCCATGATTGGCATTTGG + Intergenic
1076053392 10:127352367-127352389 CTGGCACCACAATCTGGATTTGG - Intronic
1077597653 11:3547753-3547775 GAGACTCCACAAATGGGATTCGG - Intergenic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1084253752 11:67923659-67923681 GAGACTCCACAAATGGGATTCGG - Intergenic
1084819126 11:71672267-71672289 GAGACTCCACAAATGGGATTCGG + Intergenic
1088145894 11:106677368-106677390 CTGTCACCACACTTGATATTTGG + Intronic
1088863272 11:113821853-113821875 CTGACTCCTCAATCGGGATTTGG - Intronic
1090157928 11:124461024-124461046 TTGTCTCCACAATAGAGACTGGG + Intergenic
1090434739 11:126677389-126677411 CTTTCTCCAGAATGGAGATTCGG - Intronic
1090685685 11:129115965-129115987 CTGTGTTTACAAGTGGGATTTGG - Intronic
1093051020 12:14504907-14504929 CTGTCTCCAGAAGTGAGATTTGG + Intronic
1093197935 12:16150782-16150804 CTGTCACCACAAATGGGCCTGGG - Intergenic
1096426374 12:51507329-51507351 ATGTCACCACAATTTGGATCTGG - Intronic
1100615736 12:96230572-96230594 CTGTCTCCACCCTGGGGACTTGG - Intronic
1100909786 12:99346157-99346179 CAGTCTCCACAATGCTGATTGGG + Intronic
1103602879 12:122065244-122065266 CTCTCTCCACAGGTGGGGTTGGG + Intergenic
1111552163 13:89827778-89827800 CTGTCTCCTCGGCTGGGATTTGG + Intergenic
1117642115 14:57810971-57810993 TTGTCTCAAAAACTGGGATTTGG - Intronic
1118312211 14:64702706-64702728 CTGTCTGCAAGATGGGGATTAGG + Intergenic
1118776132 14:68975172-68975194 CTGTCTGCAGAATCGGGATGTGG + Intronic
1122384532 14:101334883-101334905 CTGTCTCCACTCTGGGGAGTTGG - Intergenic
1123923903 15:25090071-25090093 CTGTGTCAACACTTGGGATGGGG + Intergenic
1127003141 15:54533807-54533829 ATGTGTCCACAGTTGGGATTGGG + Intronic
1127121764 15:55777978-55778000 CTCTCTCCACATTTGGGCTCAGG + Intergenic
1127505289 15:59592151-59592173 CTCTCTCCGCTATTGGTATTTGG + Intergenic
1128267602 15:66280305-66280327 TAATCTCCACAATTGGGGTTAGG + Intergenic
1129145372 15:73642186-73642208 CTCTCTCCACTGTTGGGGTTGGG + Intergenic
1130395823 15:83500506-83500528 CTCTCTCCACTATTGGTCTTGGG + Intronic
1131574795 15:93577510-93577532 CTCTCTCCATATTTGGGAGTTGG + Intergenic
1133580830 16:7142977-7142999 ATGACTCCAAAATTGGGACTGGG + Intronic
1134803168 16:17104190-17104212 CTGTGTCAACACTTGGGATTTGG + Exonic
1137595924 16:49723795-49723817 CTCTCTCAGCAACTGGGATTAGG - Intronic
1138025340 16:53517840-53517862 CAGTCTCCACAATTCAGTTTTGG - Intergenic
1140464517 16:75169335-75169357 CTCTTTCCTCAATTGGGGTTTGG - Exonic
1149950019 17:60975963-60975985 TTGTTTCCACATTTGGGCTTAGG + Intronic
1150229375 17:63541766-63541788 CTGGCCCCACAATTGGGAGTGGG + Intronic
1152560263 17:81075157-81075179 CTGTGCCCACATTTGGCATTGGG + Intronic
1153988676 18:10376008-10376030 CTGCCTCCACATTTGGGCTGTGG - Intergenic
1158459964 18:57637628-57637650 CCATCACCACAATTGGGGTTAGG + Intergenic
1159225208 18:65524415-65524437 TTGTCTACAAATTTGGGATTTGG - Intergenic
1167579453 19:50333114-50333136 CCGTCTCCAAAACTAGGATTCGG + Intronic
1167865177 19:52319617-52319639 CTTTCTTCAGAATTGGGATTTGG + Intronic
1167894033 19:52566649-52566671 GTGTCTCCATAATTGTGCTTAGG + Intronic
1167987536 19:53331713-53331735 GTGTCTCCATAATTGTGCTTAGG + Intergenic
1168002662 19:53461952-53461974 GTGTCTCCATAATTGTGCTTAGG + Intergenic
927238922 2:20902726-20902748 CTGTCTCCAGAGTTTGGATGAGG + Intergenic
929106925 2:38374758-38374780 CTTTTTCCACAGTTGGTATTAGG - Intronic
930631930 2:53762918-53762940 CTGTCTCTTCAATTTAGATTTGG - Intronic
932037009 2:68255609-68255631 GTGTCTCCACAATTACCATTAGG + Intronic
932932835 2:76062579-76062601 CAGTCACCACACTGGGGATTAGG - Intergenic
934144247 2:89075834-89075856 CTGTACCCACAATTGGGCCTAGG + Intergenic
934224995 2:90124714-90124736 CTGTACCCACAATTGGGCCTAGG - Intergenic
936554564 2:113483534-113483556 CAGTCTCCAGGATTGGGACTTGG + Intronic
939660360 2:144881448-144881470 GTGTCTCCACATTGGGGGTTAGG + Intergenic
944622920 2:201536858-201536880 CTGACTCTTCAATTGGTATTTGG + Intronic
946138875 2:217671140-217671162 GTGTCTCCTAAATGGGGATTTGG + Intronic
1169221577 20:3826214-3826236 CTGTCAACATAATTGGGATGAGG + Exonic
1170842514 20:19935474-19935496 CTGTTTCCATCATTGGGAGTAGG - Intronic
1173540980 20:43850840-43850862 CTGTCTCCTCAATTAGAAATTGG + Intergenic
1176720612 21:10389801-10389823 CTGTCTCCCACATGGGGATTAGG - Intergenic
1176720743 21:10390584-10390606 CTGTCTCCCACATGGGGATTAGG - Intergenic
1176962922 21:15180053-15180075 CTGTTTGCACGATTGAGATTTGG - Intergenic
1180301813 22:11042644-11042666 CTGTCTCCCACATGGGGATTAGG - Intergenic
1180301935 22:11043378-11043400 CTGTCTCCCACATGGGGATTAGG - Intergenic
950752791 3:15144132-15144154 GAGACTCCACAAATGGGATTTGG + Intergenic
954546006 3:51435388-51435410 GTGTCTCTACATGTGGGATTTGG - Intronic
957067822 3:75540131-75540153 GAGACTCCACAAATGGGATTCGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961285334 3:125797849-125797871 GAGACTCCACAAATGGGATTCGG + Intergenic
961594314 3:128005134-128005156 CTGTCTCCTCACTTGTGACTTGG - Intergenic
967073912 3:185985192-185985214 TAGTTTACACAATTGGGATTAGG - Intergenic
967832726 3:193934444-193934466 TTGTTTGCACAATTGGGATGTGG + Intergenic
971127554 4:23771083-23771105 CTGTCTCTCCAACTTGGATTGGG + Intronic
971643650 4:29167315-29167337 TTATCTCCACAATTTGTATTTGG - Intergenic
971933766 4:33119488-33119510 CCAACTCCACAATGGGGATTAGG + Intergenic
972347995 4:38209848-38209870 CTGTTGCAACAATTGGGATTAGG + Intergenic
974887384 4:67836504-67836526 CTGTCTCCAGAAGTATGATTTGG - Intronic
980797005 4:137697943-137697965 CTATCTTTACAATAGGGATTAGG + Intergenic
982131565 4:152233584-152233606 GTGGCCCCACATTTGGGATTAGG + Intergenic
982947853 4:161648646-161648668 CTGTTTACACAATTTGGGTTTGG + Intronic
983923288 4:173370474-173370496 CTGTCTCCACAAATGCGAAACGG + Intronic
984256086 4:177391683-177391705 CAGTCTTCACAATTTAGATTTGG + Intergenic
985578973 5:686789-686811 ATGCCACCACAATGGGGATTAGG - Intronic
985593819 5:778852-778874 ATGCCACCACAATGGGGATTAGG - Intergenic
989424810 5:41283989-41284011 TTGCCTCCAAGATTGGGATTGGG - Intergenic
989821082 5:45796484-45796506 CTGTTTTTACAATAGGGATTAGG + Intergenic
993176333 5:84490608-84490630 CTGTCTCCACCATTAGGCTTTGG + Intergenic
993255665 5:85587704-85587726 CTGCCTCCTCAAGTGGGATAGGG - Intergenic
995143921 5:108764993-108765015 TTGTCTTCACAAATGGGACTAGG - Intronic
996254754 5:121385408-121385430 CTGTCTCCACAATTGAAGTCAGG - Intergenic
1000781137 5:165483140-165483162 CAGGCTCCACACTTAGGATTGGG + Intergenic
1004031073 6:11870110-11870132 CTGTGTTCACATTGGGGATTAGG - Intergenic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1010707030 6:79126941-79126963 CAGTTTCCACATTAGGGATTTGG - Intergenic
1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG + Intergenic
1016550916 6:145279033-145279055 CTCTTTCCACAATTGGAAATTGG + Intergenic
1018585357 6:165351164-165351186 CTTTATACACAATTGGGCTTTGG + Intronic
1018633881 6:165843670-165843692 CTATCACCACAATGGGGACTGGG + Intronic
1019769046 7:2871796-2871818 CTGTCTCCACAGTTAGGCTGGGG + Intergenic
1022272084 7:28818436-28818458 CTGGCTGCAAAATTGGAATTTGG - Intronic
1022969605 7:35505115-35505137 CTGTCTGCACATTCAGGATTTGG - Intergenic
1023681822 7:42695181-42695203 CTGTTTGCAGAATTCGGATTGGG - Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1025745745 7:64241314-64241336 CTGTCTCCACAATTGGGATTGGG - Intronic
1027413633 7:77949707-77949729 TTGTCACTACAATTGGGAATTGG + Exonic
1033155023 7:138949490-138949512 CGGTCTCCACAGTTGGGCATGGG - Intronic
1034433419 7:151051971-151051993 CTGTCTCCACAGGTGACATTGGG + Exonic
1036246893 8:7125627-7125649 GAGGCTCCACAAATGGGATTCGG + Intergenic
1036253916 8:7188783-7188805 GAGACTCCACAAATGGGATTCGG - Intergenic
1036396457 8:8375581-8375603 CTGTTACCACAATGGTGATTAGG - Intronic
1039632109 8:39123412-39123434 CTGTCTCCACACTGGGGGTTTGG + Intronic
1044406287 8:91830458-91830480 CTGTCTCTACCATTGCCATTTGG + Intergenic
1046567463 8:115919485-115919507 CACTCTCCACAGGTGGGATTAGG - Intergenic
1047021919 8:120784593-120784615 CTCTCTCCAGAATTTGGAATTGG + Intronic
1049268183 8:141680723-141680745 CAGTCTCCCCAATTGTGGTTTGG - Intergenic
1049898446 9:133651-133673 CAGTCTCCAGGATTGGGACTTGG - Intronic
1050046218 9:1548765-1548787 CTGCCTCCACAAATAGCATTTGG + Intergenic
1053741506 9:41143953-41143975 CAGTCTCCAGGATTGGGACTTGG - Intronic
1054346718 9:63973436-63973458 CAGTCTCCAAGATTGGGACTTGG - Intergenic
1054444495 9:65300096-65300118 CAGTCTCCAGGATTGGGACTTGG - Intergenic
1054485777 9:65721402-65721424 CAGTCTCCAGGATTGGGACTTGG + Intronic
1054686840 9:68287348-68287370 CAGTCTCCAGGATTGGGACTTGG + Intronic
1056721578 9:89076458-89076480 CTTTCTCCACAATTCAGGTTAGG + Intronic
1059535204 9:115074286-115074308 ATGTCTTCACATTGGGGATTAGG - Intronic
1059773078 9:117446105-117446127 CTGACTTCACACTTTGGATTTGG - Intergenic
1061607103 9:131718856-131718878 CTGTCTCCTGAATTGCCATTTGG - Intronic
1185453705 X:296875-296897 CTGTCTCCCACATGGGGATTAGG + Intronic
1185453794 X:297365-297387 CTGTCTCCCACATGGGGATTAGG + Intronic
1185453805 X:297414-297436 CTGTCTCCCACATGGGGATTAGG + Intronic
1185453815 X:297463-297485 CTGTCTCCCACATGGGGATTAGG + Intronic
1185453825 X:297512-297534 CTGTCTCCCACATGGGGATTAGG + Intronic
1185453843 X:297610-297632 CTGTCTCCCACATGGGGATTAGG + Intronic
1185453861 X:297708-297730 CTGTCTCCCACATGGGGATTAGG + Intronic
1185453912 X:298002-298024 CTGTCTCCCACATGGGGATTAGG + Intronic
1185453946 X:298198-298220 CTGTCTCCCACATGGGGATTAGG + Intronic
1185453964 X:298296-298318 CTGTCTCCCACATGGGGATTAGG + Intronic
1185453999 X:298492-298514 CTGTCTCCCACATGGGGATTAGG + Intronic
1185454025 X:298639-298661 CTGTCTCCCACATGGGGATTAGG + Intronic
1185540303 X:897945-897967 CTGTCTCCCACATGGGGATTAGG + Intergenic
1185572594 X:1146206-1146228 CTGTCTCCCACATGGGGATTAGG + Intergenic
1185572620 X:1146353-1146375 CTGTCTCCCACATGGGGATTAGG + Intergenic
1185572684 X:1146745-1146767 CTGTCTCCCACATGGGGATTAGG + Intergenic
1185572728 X:1146990-1147012 CTGTCTCCCACATGGGGATTAGG + Intergenic
1185572747 X:1147087-1147109 CTGTCTCCCACATGGGGATTAGG + Intergenic
1185572774 X:1147234-1147256 CTGTCTCCCACATGGGGATTAGG + Intergenic
1185669162 X:1792173-1792195 ATGGGTCCACAACTGGGATTTGG - Intergenic
1185669253 X:1792772-1792794 ATGGGTCCACAATTGGGATTTGG - Intergenic
1185709025 X:2287556-2287578 CTGTCTCCCACATGGGGATTCGG - Intronic
1185743833 X:2555582-2555604 CTGTCTCCCACATGGGGATTAGG + Intergenic
1185743844 X:2555632-2555654 CTGTCTCCCACATGGGGATTAGG + Intergenic
1186361036 X:8842087-8842109 CTGGCTCCACACTGGGGCTTTGG + Intergenic
1186898924 X:14032730-14032752 CTTTCTGCACTATTGGCATTTGG + Intergenic
1187251665 X:17604432-17604454 CTGTTACCACATTTGGGATTGGG + Intronic
1195656522 X:107336647-107336669 GTGACTCCACAGTTGGGGTTTGG + Intergenic
1197552190 X:127905052-127905074 TTGTCACCACTATTGGGAATGGG - Intergenic
1197633731 X:128891174-128891196 TTGTCACCAGAAATGGGATTGGG + Intergenic
1201733932 Y:17236721-17236743 CTGTCTCCACATTTTTGATGAGG + Intergenic