ID: 1025747186

View in Genome Browser
Species Human (GRCh38)
Location 7:64253411-64253433
Sequence CAGCCTGCTCACACCAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025747181_1025747186 18 Left 1025747181 7:64253370-64253392 CCTAGTCAGTTCTTTCTAGGGAG 0: 3
1: 0
2: 7
3: 21
4: 143
Right 1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG No data
1025747182_1025747186 -5 Left 1025747182 7:64253393-64253415 CCTCTCCAGCAGATGTCCCAGCC 0: 1
1: 1
2: 12
3: 33
4: 257
Right 1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG No data
1025747183_1025747186 -10 Left 1025747183 7:64253398-64253420 CCAGCAGATGTCCCAGCCTGCTC 0: 8
1: 16
2: 16
3: 34
4: 269
Right 1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025747186 Original CRISPR CAGCCTGCTCACACCAGCAA AGG Intronic
No off target data available for this crispr