ID: 1025751117

View in Genome Browser
Species Human (GRCh38)
Location 7:64294697-64294719
Sequence GTTGTATTGTGCCATATACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025751117_1025751123 -6 Left 1025751117 7:64294697-64294719 CCAGGTATATGGCACAATACAAC 0: 2
1: 0
2: 0
3: 13
4: 123
Right 1025751123 7:64294714-64294736 TACAACCTGTGGGGAGGGAAAGG No data
1025751117_1025751128 23 Left 1025751117 7:64294697-64294719 CCAGGTATATGGCACAATACAAC 0: 2
1: 0
2: 0
3: 13
4: 123
Right 1025751128 7:64294743-64294765 AAGACACATCACTTGGGTGCTGG No data
1025751117_1025751125 16 Left 1025751117 7:64294697-64294719 CCAGGTATATGGCACAATACAAC 0: 2
1: 0
2: 0
3: 13
4: 123
Right 1025751125 7:64294736-64294758 GCCAGAAAAGACACATCACTTGG No data
1025751117_1025751127 17 Left 1025751117 7:64294697-64294719 CCAGGTATATGGCACAATACAAC 0: 2
1: 0
2: 0
3: 13
4: 123
Right 1025751127 7:64294737-64294759 CCAGAAAAGACACATCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025751117 Original CRISPR GTTGTATTGTGCCATATACC TGG (reversed) Intergenic
901244875 1:7721971-7721993 GTTGTACTGAGCAATACACCAGG - Intronic
902898532 1:19496688-19496710 TTCATATTGTGCCATATCCCAGG - Intergenic
906964785 1:50445633-50445655 CTTGTGTTGTGCCATTTACTTGG + Intronic
907684980 1:56601666-56601688 GCTGTATTATGCAATATTCCTGG - Intronic
908650341 1:66326048-66326070 GTTTTAATGTGACATAGACCAGG - Intronic
914809488 1:151016264-151016286 GAAGTATTGTGCCATATGCTGGG + Intronic
917264016 1:173200465-173200487 GTTTTATTGCACCATATACAGGG + Intronic
919579308 1:199351587-199351609 GTTCTATTGTACAATATATCTGG - Intergenic
1064310420 10:14207477-14207499 GTTATATTGTACTATAGACCAGG - Intronic
1074091355 10:110261027-110261049 GATGGAGTGAGCCATATACCAGG + Intronic
1074832287 10:117257377-117257399 GTTTTACTGTGCAATATACGTGG - Intronic
1085853837 11:80153378-80153400 TTTGTATTATTCCATATACTTGG - Intergenic
1086114807 11:83237657-83237679 GTTTTGTTGTACCATGTACCTGG + Intronic
1090589036 11:128245712-128245734 ATTATATTGTGCTATATGCCAGG - Intergenic
1094236421 12:28172478-28172500 GTTGTACTGTGCCCTGTACATGG - Intronic
1097550601 12:61063105-61063127 ATTGTATTATGCCATTTGCCTGG + Intergenic
1097683658 12:62672221-62672243 ATAGTATTCTGCCATATTCCAGG - Intronic
1097687863 12:62707958-62707980 GTAGTATTCTGCCATATTCCAGG - Intronic
1111025007 13:82509674-82509696 GTTGTTTTCTGCTTTATACCTGG - Intergenic
1113257372 13:108521607-108521629 TTTGAATAGTGCCATTTACCAGG - Intergenic
1132264719 15:100459435-100459457 CAGGTATTGTGCCGTATACCAGG - Intronic
1133083339 16:3341728-3341750 GTTGTGGTGTGCCATCTTCCTGG + Intergenic
1137009093 16:35306056-35306078 GTGGTATTGTCACATATACCTGG - Intergenic
1137035274 16:35564718-35564740 ATAGGATTGTGACATATACCTGG - Intergenic
1137035574 16:35566859-35566881 GTGAAATTGTGACATATACCTGG - Intergenic
1138732168 16:59207269-59207291 GTTGTATTTTGCATCATACCTGG + Intergenic
1145080304 17:19889318-19889340 GTTTTATGTTGTCATATACCAGG + Intergenic
1150254529 17:63733332-63733354 ATTGTATTCTGACAAATACCAGG - Intronic
1153676791 18:7462859-7462881 ATTGTATTTTGACAGATACCTGG + Intergenic
1156823219 18:41398139-41398161 GTTGTATAGCAACATATACCTGG + Intergenic
1163987632 19:20968362-20968384 GTTGCATTGTGACATATCACTGG + Intergenic
1163988143 19:20971848-20971870 GGGGCATTGTGACATATACCTGG + Intergenic
1163988156 19:20971919-20971941 GGAGTATTGTGACACATACCTGG + Intergenic
1164040537 19:21488972-21488994 TGTGTATTGTGACATATACCTGG + Intronic
1164081261 19:21863375-21863397 TTTGTATGTTGTCATATACCAGG - Intergenic
1164098829 19:22036178-22036200 GAGGTATTGTGACATATTCCTGG - Intergenic
1164099665 19:22043609-22043631 CATGTATTGTGACATATATCTGG - Intergenic
1164118710 19:22246402-22246424 GAGGTATTGTGACATATTCCTGG - Intergenic
1164129418 19:22348445-22348467 CTGGAATTGTGACATATACCTGG + Intergenic
1164170127 19:22717528-22717550 CTGGAATTGTGACATATACCTGG - Intergenic
1164180123 19:22811054-22811076 TGTGTATTGTGACATATAACAGG + Intergenic
1164181666 19:22824427-22824449 GTGGGATTGTGACATATGCCTGG + Intergenic
1164201790 19:23025231-23025253 GAGGTATTGTGACATATTCCTGG - Intergenic
1164205006 19:23051056-23051078 TTTGTATTGTGACATATAGCCGG - Intergenic
1164206991 19:23067405-23067427 TGTGTATTGTGACATATGCCTGG - Intergenic
1164210950 19:23096855-23096877 TGTGTATTGTGACATATGCCTGG + Intronic
1164227640 19:23260094-23260116 GTAGGATTGTGACATATATCTGG - Intergenic
1164227897 19:23261986-23262008 GGTGTATTGTGACATATTGCTGG - Intergenic
1164233808 19:23314743-23314765 GGTGTATTGTGCCATATTTTTGG + Intronic
1164282605 19:23782016-23782038 GGTGTATTGTGACATATTGCTGG + Intronic
1164283327 19:23788506-23788528 TTTGCATTGTGACATATAGCTGG + Intronic
1164294814 19:23900581-23900603 TTTGCATTGTGACATATAGCTGG + Intergenic
1164313097 19:24063471-24063493 GATGTATTGTGACATATTGCTGG + Intronic
1168030121 19:53672849-53672871 TTTGTTTGGTGCCATAGACCTGG + Intergenic
929806973 2:45154580-45154602 GTTGTCTTATTCCAAATACCTGG + Intergenic
930687995 2:54330008-54330030 GTTGAATTCTGCCTTATATCAGG - Intergenic
933426348 2:82117237-82117259 ATTGTATTTTTCCATATAGCAGG - Intergenic
936725347 2:115308107-115308129 ATTGAATTGTGCCATAAACCCGG - Intronic
942762016 2:179410922-179410944 GAAGTATTTTGCCATAGACCAGG - Intergenic
946866535 2:224045921-224045943 GTGGTATTGTGCCAGATCCAAGG - Intergenic
1171365680 20:24622365-24622387 TTTGTATTGTTCCACATTCCTGG - Intronic
1173458529 20:43223235-43223257 GTTGTATGATGCCTTAGACCAGG - Intergenic
1179061896 21:37986928-37986950 GTTTTATAGTGCCATATAGCTGG - Intronic
1182843682 22:33413340-33413362 TTTGTATTCTGGCATATAGCAGG - Intronic
1184994633 22:48196553-48196575 GTTGTGTTGTGCAAAATACATGG - Intergenic
953369988 3:42379377-42379399 GTTACATTGTGCCATTTTCCAGG - Intergenic
963076035 3:141346912-141346934 GTTTTATTCTGCCATCTGCCTGG + Intronic
967825303 3:193872794-193872816 TTTGTATTGTTCCAAAAACCAGG + Intergenic
976304661 4:83547884-83547906 GCTGTATTGTGCCAAATTCCTGG + Intronic
976610873 4:87029089-87029111 GTTGTAATTTGTCAGATACCTGG + Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
979003953 4:115264659-115264681 GATGTATTGTGTCATATTTCTGG - Intergenic
981747635 4:148066904-148066926 ATTGTAGTGTGCCATAGACGAGG + Intronic
984045630 4:174794521-174794543 ATTGTATTGTCCCAAATTCCTGG + Intronic
987109544 5:14672423-14672445 GCTGTACTAGGCCATATACCAGG + Intronic
994296871 5:98100704-98100726 GGTGGATGGTGCCATAAACCAGG - Intergenic
994325360 5:98440129-98440151 TTTTTATGTTGCCATATACCAGG - Intergenic
995276792 5:110286422-110286444 GTTGTACTGTGCCATATGTTAGG + Intergenic
999422932 5:151460466-151460488 CTTGTATTGTGACATTTTCCAGG + Intronic
1003283990 6:4718183-4718205 TATGTATTATGCCATAGACCAGG + Intronic
1008301048 6:49839966-49839988 TTTGTATTGTGCTACATACATGG + Intronic
1008632198 6:53372697-53372719 CTTGTATTGTCCCATAGACAAGG - Intergenic
1013912637 6:115296171-115296193 TTTCTATTATGCCATCTACCTGG - Intergenic
1014812153 6:125899463-125899485 TTTGTATTCTGATATATACCTGG - Intronic
1014814812 6:125923801-125923823 GTTGTAATGAGCCATATACATGG + Intronic
1015203977 6:130614330-130614352 TTTGTTTTGTGCCAAATACTGGG + Intergenic
1015809999 6:137152925-137152947 CTAGTATAGTGCCATATTCCAGG + Intronic
1017331475 6:153203191-153203213 GTTCAATTGTGACATATACCAGG + Intergenic
1017697081 6:157026864-157026886 GTGGTATTGTGACAGTTACCTGG + Intronic
1020769272 7:12367821-12367843 TTTGGCTTGTGCCATATAGCTGG + Intronic
1024462906 7:49678570-49678592 GTTCTATTGTGTAAAATACCTGG - Intergenic
1024789864 7:52953256-52953278 GTTGGATTTTGCTATATACCAGG + Intergenic
1025160897 7:56659673-56659695 GTGGTATTGTGACATATAATTGG + Intergenic
1025161217 7:56662882-56662904 TTGGGATTGTGACATATACCTGG + Intergenic
1025722232 7:64027256-64027278 ATAGAATTGTGACATATACCTGG - Intergenic
1025722563 7:64029713-64029735 GTAAAATTGTGGCATATACCTGG - Intergenic
1025743904 7:64226284-64226306 GTTGTATTGTGCCATATACCTGG - Intronic
1025744081 7:64227602-64227624 GTGAAATTGTGGCATATACCTGG - Intronic
1025745653 7:64240316-64240338 GGTGTATTGTGACACATACATGG + Intronic
1025750298 7:64288310-64288332 GTGGTATTGTGACATATATCTGG - Intergenic
1025750961 7:64293569-64293591 ATAGAATTGTGACATATACCTGG - Intergenic
1025751117 7:64294697-64294719 GTTGTATTGTGCCATATACCTGG - Intergenic
1025751301 7:64296022-64296044 GTGAAATTGTGGCATATACCTGG - Intergenic
1025759827 7:64379448-64379470 GAGAAATTGTGCCATATACCTGG + Intergenic
1025787416 7:64656192-64656214 GTGGGATTGTGACATATATCTGG + Intergenic
1027460321 7:78444085-78444107 GTTGAAATGTGACATACACCAGG - Intronic
1027570785 7:79864212-79864234 CCTGTATTGTTCCATATACTTGG - Intergenic
1028442353 7:90878673-90878695 GGTGTAATGTGTCATATACTTGG - Intronic
1039413794 8:37376785-37376807 GTTGTAATGTGCCATGTTCTAGG - Intergenic
1040358984 8:46646817-46646839 GTGAAATTGTGACATATACCTGG + Intergenic
1040377421 8:46839772-46839794 GTGAAATTGTGACATATACCTGG + Intergenic
1040378930 8:46853452-46853474 GTGAAATTGTGACATATACCTGG + Intergenic
1040382246 8:46884240-46884262 GTTGCATTGTGACATATCACTGG - Intergenic
1041679148 8:60569366-60569388 ATTGTATTATGACATATTCCTGG + Intronic
1047339953 8:123971483-123971505 TTTATATTGTGCCATAGACCAGG + Intronic
1050448246 9:5750499-5750521 TTTGTTCTGTGCCAAATACCTGG - Intronic
1050794645 9:9522985-9523007 GTTGTTTTCTGCTATATACATGG - Intronic
1053748632 9:41230799-41230821 TTTGTTTTGTGCTATTTACCTGG + Intergenic
1054337744 9:63822589-63822611 TTTGTTTTGTGCTATTTACCTGG - Intergenic
1203442887 Un_GL000219v1:27969-27991 GTGGTATTGTGACATATTGCTGG - Intergenic
1203445454 Un_GL000219v1:50444-50466 TTTGTTTTGTGCTATTTACCTGG - Intergenic
1203513695 Un_KI270741v1:146878-146900 GTGGTATTGTGACATATTGCTGG - Intergenic
1189883426 X:45514805-45514827 GATATTTTGTGCCATATTCCAGG - Intergenic
1198343652 X:135739061-135739083 ATTGGATTCTGCCATATATCCGG + Intergenic
1199358006 X:146883414-146883436 GTTGTATTTTTCCCTATGCCTGG + Intergenic
1200843986 Y:7812731-7812753 GTGAAATTGTGCCATATACATGG - Intergenic
1200854450 Y:7922107-7922129 GTTGTATTGTAAAATATCCCTGG - Intergenic
1200859671 Y:7977024-7977046 GGTGTATTGTGACATACAACTGG - Intergenic
1200891859 Y:8332466-8332488 GTTAGATTGTGCCATGTACCTGG + Intergenic
1202244876 Y:22810027-22810049 GTGAAATTGTGACATATACCTGG + Intergenic
1202260544 Y:22965873-22965895 GTTAAATTGTGACATATAACTGG + Intergenic
1202264810 Y:23006926-23006948 GGAGCATTGTGCCATATATCTGG + Intergenic
1202397865 Y:24443773-24443795 GTGAAATTGTGACATATACCTGG + Intergenic
1202413531 Y:24599614-24599636 GTTAAATTGTGACATATAACTGG + Intergenic
1202417801 Y:24640668-24640690 GGAGCATTGTGCCATATATCTGG + Intergenic
1202452985 Y:25029418-25029440 GGAGCATTGTGCCATATATCTGG - Intergenic
1202457254 Y:25070472-25070494 GTTAAATTGTGACATATAACTGG - Intergenic
1202472916 Y:25226314-25226336 GTGAAATTGTGACATATACCTGG - Intergenic