ID: 1025752715

View in Genome Browser
Species Human (GRCh38)
Location 7:64307305-64307327
Sequence TCCCTAGGTTGCAGGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025752715_1025752719 22 Left 1025752715 7:64307305-64307327 CCTGCAGTCCTGCAACCTAGGGA No data
Right 1025752719 7:64307350-64307372 ATCTCTCAGCATGTCTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025752715 Original CRISPR TCCCTAGGTTGCAGGACTGC AGG (reversed) Intergenic
No off target data available for this crispr