ID: 1025753240

View in Genome Browser
Species Human (GRCh38)
Location 7:64311582-64311604
Sequence CCTCAGATGGTGCCAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025753232_1025753240 14 Left 1025753232 7:64311545-64311567 CCCAGTGAGGTTTTGCCTGAGCT 0: 1
1: 1
2: 0
3: 9
4: 139
Right 1025753240 7:64311582-64311604 CCTCAGATGGTGCCAATGGAAGG No data
1025753235_1025753240 -1 Left 1025753235 7:64311560-64311582 CCTGAGCTGGACTCAGACTCTCC 0: 3
1: 0
2: 1
3: 31
4: 319
Right 1025753240 7:64311582-64311604 CCTCAGATGGTGCCAATGGAAGG No data
1025753233_1025753240 13 Left 1025753233 7:64311546-64311568 CCAGTGAGGTTTTGCCTGAGCTG 0: 1
1: 1
2: 2
3: 16
4: 179
Right 1025753240 7:64311582-64311604 CCTCAGATGGTGCCAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025753240 Original CRISPR CCTCAGATGGTGCCAATGGA AGG Intronic
No off target data available for this crispr