ID: 1025754109

View in Genome Browser
Species Human (GRCh38)
Location 7:64318807-64318829
Sequence TGTATCTAAAAGCCCTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025754109 Original CRISPR TGTATCTAAAAGCCCTAGAG AGG Intronic
902877646 1:19350331-19350353 TGTACACAAAAGGCCTAGAGCGG + Intronic
907340344 1:53731050-53731072 TGTCTTTGAAAGCCATAGAGGGG + Intronic
907953580 1:59206980-59207002 TTTATCTAAAAGCCCCTGACTGG - Intergenic
909139590 1:71846643-71846665 TGTAACAAAAAGCCTTAGAATGG + Intronic
912270998 1:108209089-108209111 TTTATCTATAAGCCCTTGACTGG + Intergenic
915003919 1:152619279-152619301 TGTATCTACAATGCCTAGAGTGG - Intergenic
915688484 1:157662144-157662166 TATATCTATAAGCCCTTGACTGG - Intergenic
916609580 1:166377867-166377889 TGTACCTGGAAGCCCTGGAGGGG - Intergenic
918779185 1:188674183-188674205 TGTATTTAAAAGCATTACAGAGG + Intergenic
919336984 1:196248226-196248248 TGCATCTTAAAGCACTAGAAAGG + Intronic
919532548 1:198742083-198742105 TGTCTCTAACAGCCCTAGGCAGG - Intronic
922396394 1:225205473-225205495 TGTAACAAAAAGCCTTAGACTGG - Intronic
924493964 1:244568486-244568508 TTTATCTATAAGCCCCTGAGTGG + Intronic
1064963110 10:20988156-20988178 TGTATCCAAAAGGCCCAGTGTGG + Intronic
1068294172 10:55046251-55046273 TGTATCTAGCAGCCCAAAAGAGG + Intronic
1069085290 10:64131740-64131762 TTTATCACAAAACCCTAGAGGGG + Intergenic
1071809315 10:89161285-89161307 TTTCTCTAAAAGCCTTAGAGAGG - Intergenic
1074002288 10:109385616-109385638 TGAACCTAAAACCCCTACAGAGG + Intergenic
1078350020 11:10585295-10585317 TGTATATGAGAGCCCTATAGGGG - Intronic
1080263749 11:30379136-30379158 TGTATTTGAAAGCCGTAGAATGG + Intergenic
1081602479 11:44504979-44505001 TGTAACAAAATGCCCTAGACTGG + Intergenic
1083507067 11:63167662-63167684 TTTATCTATAAGCCCTTGACTGG - Intronic
1086769283 11:90741246-90741268 TGAATCTAAAATACCTAGAATGG - Intergenic
1089416696 11:118298084-118298106 TGTATCCAACAGCCCTTGAAAGG - Intergenic
1090798358 11:130154739-130154761 TGTAACCACAAGGCCTAGAGTGG + Intergenic
1091809482 12:3383731-3383753 TGTAACAAAATGCCCTAGAGCGG - Intronic
1092320756 12:7472051-7472073 TTTATCTATAAGCCCCTGAGGGG - Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1095832306 12:46601228-46601250 TTTTTCTATAAGCCCTTGAGTGG + Intergenic
1096320883 12:50611776-50611798 TCTTGCTAAAAGCCCGAGAGAGG - Intronic
1098052744 12:66471699-66471721 TGTATATAAAAGCCCATGAGAGG - Intronic
1101571553 12:105958392-105958414 TTTATTTAAAAGCTTTAGAGTGG - Intergenic
1103354124 12:120307047-120307069 TATTTCTTTAAGCCCTAGAGAGG + Intronic
1104607966 12:130203773-130203795 TGTATCTTAAAGCTCTCAAGTGG - Intergenic
1105039722 12:132953257-132953279 TGTCTCTGAAGGCCCTGGAGGGG - Intronic
1106620011 13:31363906-31363928 TGTATCACATAGCCCTTGAGAGG - Intergenic
1108644707 13:52415363-52415385 TGCTTCTAAAAGCCCTGGGGAGG + Exonic
1109458654 13:62626348-62626370 TGTGTCTAAAAGACCGAGGGGGG + Intergenic
1109759538 13:66809236-66809258 TGTATTTAAAAGGCCTGGCGCGG - Intronic
1110996468 13:82115970-82115992 TGTTTATAAATACCCTAGAGTGG + Intergenic
1112140163 13:96632356-96632378 TGTAACAAAATGCCCTAGAATGG - Intronic
1112546481 13:100376493-100376515 TTTATCTAGAAGCCCCTGAGTGG + Intronic
1113662513 13:112117211-112117233 TGTCTCTGAAATCTCTAGAGAGG - Intergenic
1117345680 14:54829760-54829782 TGTATCTGAAAGCTTTAGAAGGG + Intergenic
1117662752 14:58024749-58024771 TGCAATTAAAAGCCCTACAGTGG - Intronic
1118121087 14:62843708-62843730 TGTATTTAAAAGCCATGTAGGGG - Intronic
1119919616 14:78434317-78434339 TCTATCTACAAGCCAAAGAGAGG - Intronic
1120526694 14:85584892-85584914 CGTATCCAAAAGGCATAGAGTGG + Intronic
1120844264 14:89112262-89112284 TGTATCTAGCAGCTCTAGTGGGG + Intergenic
1121261132 14:92566922-92566944 GGTATCTAAAATCCCTAGCCTGG + Intronic
1124802691 15:32849602-32849624 TTTATCTAAAAGGGCTAGAGGGG - Intronic
1125094047 15:35830467-35830489 TGTATCTGAAACCCTGAGAGCGG - Intergenic
1126968293 15:54081747-54081769 TCTATTTAAAAGACATAGAGTGG - Intronic
1128527060 15:68419662-68419684 TGTTTCTAAAAGCCCTTTAGGGG - Intronic
1131397040 15:92094745-92094767 TTCATCTAAAAATCCTAGAGGGG - Intronic
1132464125 16:69929-69951 TGTGTCTACAGGCCCTAGGGCGG - Intronic
1133851992 16:9513818-9513840 TGTGTCTAAAATCTCTTGAGAGG + Intergenic
1134361836 16:13538324-13538346 TGTTTATAAAAGCCCGAGAAAGG - Intergenic
1135543593 16:23351075-23351097 TGTTTTTAAAAGTCCTAGAAGGG + Intronic
1136955077 16:34773967-34773989 TGTATCTGATAGGCCTACAGTGG + Intergenic
1138927956 16:61614797-61614819 TGCATCTAAAAGCTTCAGAGAGG - Intergenic
1138959483 16:62011464-62011486 TGTTTGGAAAAGCCCTAGTGAGG - Intronic
1139471865 16:67182444-67182466 TGTATGTAAAACCACAAGAGTGG - Intronic
1143068720 17:4271240-4271262 TGAATCTAAAAGCATTACAGGGG - Exonic
1143977837 17:10843532-10843554 CGTATTTAAAAGCTCCAGAGTGG + Intergenic
1143999137 17:11036418-11036440 TGTGTCAGAAAGCCCTACAGTGG + Intergenic
1146168568 17:30613443-30613465 TGTATATAAAAATACTAGAGGGG - Intergenic
1146221543 17:31026944-31026966 TGTATATAAAGACACTAGAGGGG - Intergenic
1148318261 17:46723831-46723853 TGTATAGAAAAGCATTAGAGGGG - Intronic
1150366250 17:64588573-64588595 TGTATATAAAAATACTAGAGGGG + Intronic
927220200 2:20700190-20700212 AGTAGCTGAAAGCCCTGGAGAGG + Intronic
928291099 2:30037968-30037990 TGAATCTAAAATCCCCAGTGTGG - Intergenic
928721608 2:34127574-34127596 TGTATGTAAAAGCACAGGAGAGG + Intergenic
929528068 2:42724834-42724856 TGAAACAAACAGCCCTAGAGAGG - Intronic
929859640 2:45665982-45666004 TGACTCTAGAAGCCCTAGAAAGG - Intronic
931461792 2:62456533-62456555 TGTGACTGAAAGCCCTTGAGTGG - Intergenic
932176368 2:69606660-69606682 TGTATCTCCAATACCTAGAGAGG - Intronic
935399464 2:102644795-102644817 TTTATCTATAAGCCCTTGACAGG - Intronic
936490330 2:112964718-112964740 TTTTTGTAAAAGCCCTAGATGGG + Intergenic
936640238 2:114303943-114303965 TTTATCTATAAGCCCTTGACTGG + Intergenic
940514833 2:154669825-154669847 TTGATCTAAAAGTCCTTGAGAGG + Intergenic
944026437 2:195174913-195174935 TGTATTAAATAGCCTTAGAGAGG - Intergenic
944169404 2:196758259-196758281 TGTATCTATAAGTCCTTGACTGG + Intronic
946181596 2:217952404-217952426 TGCCTCTAAAAGGCCCAGAGAGG + Intronic
1168789190 20:564498-564520 TGCAGCTAAAATCCATAGAGTGG - Intergenic
1169605904 20:7319131-7319153 TTTATCTAAAAGCCCCTGACTGG - Intergenic
1169646232 20:7812803-7812825 TTTATCTAAAAGCCCCTGACTGG + Intergenic
1171163529 20:22950493-22950515 TGTAGCTTAAAGCCCTCAAGGGG - Intergenic
1173042131 20:39474570-39474592 TCTACATAACAGCCCTAGAGGGG - Intergenic
1177587308 21:23114669-23114691 TGTTGTTAAATGCCCTAGAGCGG - Intergenic
1179303917 21:40137575-40137597 TGTATTAAACAGCCCTACAGAGG - Intronic
1180059173 21:45375793-45375815 TTCATCTAAAAGCCCCAGAGAGG - Intergenic
1181979117 22:26753454-26753476 TGGATCTTGAAGCCCTAGTGAGG - Intergenic
1182204525 22:28610084-28610106 TTTATCTATAAGCCCTTGACTGG - Intronic
1182952457 22:34390458-34390480 TTTATCTAAAAGCCCCTGATTGG + Intergenic
951795451 3:26533641-26533663 TTTATCTATAAGCCCCTGAGTGG + Intergenic
955094903 3:55787586-55787608 AGTAACTAAAAGCTCTAAAGAGG - Intronic
957249702 3:77757241-77757263 TTGATCTATAAGCCCTTGAGTGG - Intergenic
957776531 3:84761507-84761529 TTTATCTAAAAGCCCCTGACTGG - Intergenic
962028094 3:131569962-131569984 TATATATAAAATACCTAGAGAGG - Intronic
962036016 3:131652441-131652463 TATTTTTAAAAGTCCTAGAGAGG - Intronic
963153863 3:142075568-142075590 AGTATCTCAAAGCAGTAGAGAGG - Intronic
965057041 3:163733698-163733720 TGTATCCCAAACCCCTAGATAGG - Intergenic
966255174 3:177908964-177908986 TTTATCTAAAAGCCCCTGACTGG - Intergenic
967141837 3:186568020-186568042 TGTATCTATCACACCTAGAGAGG - Intronic
970677472 4:18467883-18467905 TGTTTCTAAAAGCTCCAGAGAGG + Intergenic
973038984 4:45446758-45446780 TGTGTCTAAAGGCCAAAGAGAGG + Intergenic
973840032 4:54852042-54852064 TGTATTCAAGAGCCCCAGAGAGG + Intergenic
974251742 4:59394168-59394190 TTTATCTAAAAGCCCCTGAGTGG + Intergenic
975096669 4:70464744-70464766 TGTATCTATAAGCCCCTGACTGG - Intronic
975763795 4:77645145-77645167 TGTATCTTAAAGAACTAGAAAGG + Intergenic
977239649 4:94552516-94552538 TATATTTAAAAGCCCCAAAGAGG + Intronic
981131615 4:141163299-141163321 TTTATCTATAAGCCCTTGACTGG - Intronic
983047442 4:163004364-163004386 TTTATCTATAAGCCCCTGAGTGG + Intergenic
983298997 4:165901888-165901910 TTTATCTATAAGCCCCTGAGTGG + Intronic
983435864 4:167714407-167714429 TTTATCTGAAAGCCTTAGACTGG - Intergenic
987228795 5:15870807-15870829 TTTATCTATAAGCCCCTGAGTGG - Intronic
989115266 5:37946268-37946290 TGTATCTAAAAAACATCGAGTGG + Intergenic
989780667 5:45261726-45261748 TATATCTAAATTCCCAAGAGAGG - Exonic
995054367 5:107743052-107743074 TGAAACTAAAAGCCGTAGAGAGG + Intergenic
995941191 5:117586679-117586701 TGTATCAAAAAGCACTAAAGGGG + Intergenic
996129977 5:119770025-119770047 TTTATCTATAAGCCCCTGAGTGG - Intergenic
1000065288 5:157688919-157688941 TGAAACTAAAAGCCCTGGACAGG + Intergenic
1002117100 5:176971208-176971230 TTTAGCAAAAAGCTCTAGAGTGG - Intronic
1003325954 6:5090954-5090976 TGTAAGGAACAGCCCTAGAGAGG + Intergenic
1004568825 6:16825177-16825199 TGTATCGAGAACCCCAAGAGGGG - Intergenic
1005468996 6:26143357-26143379 TCTATATGAAATCCCTAGAGTGG + Intergenic
1007960218 6:45952087-45952109 TGTATCTGTAAGCCACAGAGAGG - Intronic
1009536718 6:64896952-64896974 TTTATCTATAAGCCCCTGAGTGG - Intronic
1010889759 6:81292252-81292274 TTTATATCAAAGCCCTTGAGAGG - Intergenic
1011736180 6:90313089-90313111 TGCTTCTCAAAGCCCTAGTGTGG + Intergenic
1012584407 6:100904780-100904802 TGAATATAAAATCCCTAGTGTGG - Intergenic
1014210029 6:118699069-118699091 TGTATTTAAAATACTTAGAGTGG - Intronic
1014225476 6:118841645-118841667 TGATTCTAACAGCCCTAGAAGGG - Intronic
1014248471 6:119092615-119092637 TGTATCTAACAGCCCTTGAAAGG + Intronic
1017574444 6:155786593-155786615 TTTATCTAAAAGGGATAGAGTGG + Intergenic
1022906482 7:34862527-34862549 TCTATCTAAAATACCTAGTGTGG + Intronic
1025725074 7:64050305-64050327 TGTATCTAACAGCCCTAGAGAGG + Intronic
1025754109 7:64318807-64318829 TGTATCTAAAAGCCCTAGAGAGG + Intronic
1026129913 7:67611845-67611867 TGTTTCTAAGACTCCTAGAGTGG - Intergenic
1029815416 7:103089616-103089638 TCTAGATAAAAGCTCTAGAGTGG + Intronic
1031210623 7:118821715-118821737 TGTATTTAAAAGCTCCACAGTGG + Intergenic
1032152002 7:129436724-129436746 ATTTTCTAAAAGCCCTAGAGAGG - Intronic
1032890387 7:136189102-136189124 TGTTTCTAACAGCTCTGGAGTGG - Intergenic
1034205024 7:149307755-149307777 GGGATGTAAAAGCCCTACAGCGG - Intergenic
1035200054 7:157257027-157257049 TGTACCTTAAACCCCAAGAGAGG - Exonic
1035881257 8:3246132-3246154 TTTATTTAAAAACCCTTGAGTGG + Intronic
1037377305 8:18244912-18244934 TCCAACTAAAAGACCTAGAGTGG + Intergenic
1039716864 8:40119156-40119178 TGAATCCAAAAGTCCCAGAGAGG + Intergenic
1042073633 8:64964070-64964092 TGTATTTAAAAGTCCTTAAGAGG + Intergenic
1044043133 8:87395619-87395641 TCTCTCTAAAAGCAGTAGAGGGG + Intronic
1044503605 8:92991249-92991271 TATATCTAAAAGCCCCTGACTGG - Intronic
1046489081 8:114923706-114923728 TATATCTAAATGCTTTAGAGTGG + Intergenic
1050926610 9:11271126-11271148 TTTATCTAAACACCCAAGAGTGG + Intergenic
1051400286 9:16674073-16674095 TATATCTAAAAGGCTTTGAGTGG - Intronic
1051814353 9:21087705-21087727 TCTATCTATAAGCCCTTGACTGG - Intergenic
1051863357 9:21651497-21651519 TGTATCTATAAGCCCCTGACTGG + Intergenic
1053106011 9:35408966-35408988 TCTATTTAAAAGCCCAAGTGAGG + Intergenic
1055057404 9:72036515-72036537 TGTATCCAACAGCCCTAGACAGG - Intergenic
1189647312 X:43147558-43147580 TGGAGCTAAAAGCCCTATATGGG - Intergenic
1191024308 X:55896890-55896912 TTTATCTATAAGCCCTTGACTGG - Intergenic
1192403733 X:70863051-70863073 TGTATCTATAAGCCCATGACTGG - Intronic
1192674621 X:73182882-73182904 TTTATCTATAAGCCCCTGAGTGG - Intergenic
1194158573 X:90422920-90422942 TTTATCTATAAGCCCTTGACAGG - Intergenic
1194203553 X:90983805-90983827 TTTATCTATAAGCCCCTGAGTGG - Intergenic
1194419966 X:93661205-93661227 TTTATCTATAAGCCCCTGAGTGG - Intergenic
1194545184 X:95225445-95225467 TTTATCTATAAGCCCCTGAGTGG - Intergenic
1194959033 X:100214416-100214438 TGTATCTATAAGCCCCTGACTGG + Intergenic
1196946556 X:120832705-120832727 TTTATCTATAAGCCCCTGAGTGG + Intergenic
1198274256 X:135086658-135086680 TATATCTAAAAGCCCTTGGGAGG + Intergenic
1199771992 X:150981075-150981097 TGTCTCCACAAGGCCTAGAGGGG - Intronic
1200549383 Y:4559244-4559266 TTTATCTATAAGCCCCTGAGTGG - Intergenic
1201376767 Y:13330993-13331015 TTTATCTGAAAGCCCCTGAGTGG - Intronic