ID: 1025760916

View in Genome Browser
Species Human (GRCh38)
Location 7:64390576-64390598
Sequence GGGTTAATGACACCATGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025760912_1025760916 11 Left 1025760912 7:64390542-64390564 CCTCAATTATGGAAATGTACAGT No data
Right 1025760916 7:64390576-64390598 GGGTTAATGACACCATGTTCTGG No data
1025760911_1025760916 16 Left 1025760911 7:64390537-64390559 CCATTCCTCAATTATGGAAATGT No data
Right 1025760916 7:64390576-64390598 GGGTTAATGACACCATGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025760916 Original CRISPR GGGTTAATGACACCATGTTC TGG Intergenic
No off target data available for this crispr