ID: 1025761651

View in Genome Browser
Species Human (GRCh38)
Location 7:64401447-64401469
Sequence ATGTGACAGACTAATACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025761651_1025761658 20 Left 1025761651 7:64401447-64401469 CCACATGTATTAGTCTGTCACAT No data
Right 1025761658 7:64401490-64401512 TTATGTGACCCTCCTTCTTAGGG No data
1025761651_1025761657 19 Left 1025761651 7:64401447-64401469 CCACATGTATTAGTCTGTCACAT No data
Right 1025761657 7:64401489-64401511 TTTATGTGACCCTCCTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025761651 Original CRISPR ATGTGACAGACTAATACATG TGG (reversed) Intergenic
No off target data available for this crispr