ID: 1025764131

View in Genome Browser
Species Human (GRCh38)
Location 7:64426355-64426377
Sequence CATATTTAGCAAGTGGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025764128_1025764131 16 Left 1025764128 7:64426316-64426338 CCTTCAATGTTCGCAGTTTCTAA No data
Right 1025764131 7:64426355-64426377 CATATTTAGCAAGTGGTCATGGG No data
1025764127_1025764131 22 Left 1025764127 7:64426310-64426332 CCGCATCCTTCAATGTTCGCAGT No data
Right 1025764131 7:64426355-64426377 CATATTTAGCAAGTGGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025764131 Original CRISPR CATATTTAGCAAGTGGTCAT GGG Intergenic
No off target data available for this crispr