ID: 1025766796

View in Genome Browser
Species Human (GRCh38)
Location 7:64463675-64463697
Sequence GCCTGAAAAGGCGGCAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025766790_1025766796 16 Left 1025766790 7:64463636-64463658 CCTCTGGGGCGGGACTGGCTCAG No data
Right 1025766796 7:64463675-64463697 GCCTGAAAAGGCGGCAGCTTAGG No data
1025766789_1025766796 17 Left 1025766789 7:64463635-64463657 CCCTCTGGGGCGGGACTGGCTCA No data
Right 1025766796 7:64463675-64463697 GCCTGAAAAGGCGGCAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025766796 Original CRISPR GCCTGAAAAGGCGGCAGCTT AGG Intergenic