ID: 1025773607

View in Genome Browser
Species Human (GRCh38)
Location 7:64537630-64537652
Sequence AAAAAACAGAATAGACGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1346
Summary {0: 1, 1: 0, 2: 5, 3: 75, 4: 1265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025773607 Original CRISPR AAAAAACAGAATAGACGGCC AGG Intronic
901307771 1:8245614-8245636 AAAAAAAAAAAAAAACGGCCGGG + Intergenic
901575504 1:10197696-10197718 AAAAAAAAAAAAAGAGGGCCAGG - Intergenic
901885427 1:12219368-12219390 AAAAAAGAGAAAAGGTGGCCGGG - Intergenic
902039945 1:13485280-13485302 AAAAAAAAAAAAAAACGGCCAGG + Intronic
902072920 1:13756272-13756294 AAAAAAAAGAATTGAGGGCTTGG + Intronic
902153804 1:14466671-14466693 AAAAAGAAGAAGAAACGGCCAGG + Intergenic
902347307 1:15827875-15827897 AACAAACAAAAAAAACGGCCAGG + Intergenic
902355022 1:15891643-15891665 AAAAAACAAAAAACAAGGCCGGG - Intronic
902521674 1:17021446-17021468 AAAAAACAGATGAGAGGGGCCGG + Intronic
903149593 1:21397281-21397303 AAAAAAAAAAATAGCCGGGCGGG - Intergenic
903614163 1:24640224-24640246 TAAAAACAGGTTAAACGGCCGGG + Intronic
903865461 1:26394369-26394391 AAAAAACAGAGAATAGGGCCAGG + Intergenic
903869712 1:26425036-26425058 ATAAAATAGAACAGAGGGCCGGG - Intronic
903918915 1:26785771-26785793 AAAAAACAGAACAGACTGATGGG + Intergenic
903955178 1:27020624-27020646 AAAAAAAAAAACAGAAGGCCAGG - Intergenic
903994244 1:27295747-27295769 AACAAACAAAATAGAAGGTCAGG - Intronic
904024089 1:27491182-27491204 AAAAAACAAAAAAAACGCCCAGG + Intergenic
904048309 1:27622799-27622821 TAAAAATGAAATAGACGGCCGGG - Intronic
904146265 1:28394584-28394606 AAAAAAAAGAAAAGATGGCCAGG - Intronic
904161380 1:28524560-28524582 AAAAAATAAAATAAAAGGCCAGG + Intronic
904362311 1:29984313-29984335 AAACAATAGAATAGACTTCCAGG - Intergenic
904478633 1:30780312-30780334 AAAAAAAATAACAGATGGCCAGG - Intergenic
904519282 1:31081997-31082019 AAAAAAAAGGATAGGAGGCCAGG + Intergenic
904522529 1:31106620-31106642 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
904817464 1:33216304-33216326 AAGAAACAGAAAAAAGGGCCGGG + Intergenic
904820954 1:33243905-33243927 AAAATACATAAAAGTCGGCCAGG - Intergenic
905063982 1:35164168-35164190 ACAAAACAGAATAATCAGCCAGG + Intergenic
905163331 1:36057033-36057055 AAGAAAAAGAATAGTAGGCCGGG - Exonic
905412905 1:37784194-37784216 AAAAAACAGAATTGAAGCACAGG - Intergenic
905433534 1:37941641-37941663 AAAAAATAAAATAAAGGGCCGGG + Intronic
905568705 1:38987191-38987213 AAAATACAAAATAGCAGGCCTGG - Intergenic
905574221 1:39030409-39030431 AAAAAAAAAAAAAGATGGCCCGG + Intronic
905610999 1:39351360-39351382 AAAACACAGACTAGCCAGCCTGG - Intronic
905649126 1:39644861-39644883 AAAAAACAAAAAAGAGGGGCAGG + Intergenic
905703332 1:40035897-40035919 AAAAAAAAAAAAAGAAGGCCGGG + Intergenic
905810270 1:40907720-40907742 AAAAAAGAGAAAACATGGCCAGG + Intergenic
905817565 1:40963917-40963939 AAAATACAGAATTTATGGCCAGG + Intergenic
906104081 1:43281424-43281446 AAAAAAAAAAAAAGATGGCCAGG + Intergenic
906250068 1:44304313-44304335 AATAAACAGAAAAGACAACCAGG + Intronic
906254715 1:44339374-44339396 AAAAAAAAGAACAGAGAGCCTGG + Intronic
906386430 1:45372741-45372763 AAAAAAAAGAAAAGAAGGCCAGG + Intronic
906747676 1:48233065-48233087 AAAGAAAAGAAAAGAAGGCCAGG + Intronic
906750671 1:48256545-48256567 AAAAAGCTGAATAGAGGGCAGGG + Intergenic
907187715 1:52623384-52623406 AAAAAAAAGAAAATAAGGCCAGG + Intergenic
907199791 1:52716684-52716706 AAAAAAAAAAAAAGAAGGCCTGG + Intergenic
907215847 1:52862942-52862964 AAAAAACAAAAAAAACAGCCAGG - Intronic
908524009 1:64970141-64970163 AAAAAAAAAAAAAAACGGCCGGG + Intergenic
908726989 1:67186914-67186936 AAAAAAAGGAATAAAGGGCCAGG - Intronic
908894231 1:68880873-68880895 AAAAAACAGAATAGAAAAACTGG - Intergenic
909060783 1:70876783-70876805 ATAGAACAGAATAGAAAGCCCGG - Intronic
909614358 1:77590075-77590097 TAAAAACAAAAAAGAGGGCCAGG + Intronic
909921281 1:81383665-81383687 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
910175612 1:84427189-84427211 AAAAAACAGAATTGAAGGAGAGG + Intergenic
910486927 1:87724693-87724715 AAAAAAAAGAATACATGACCAGG + Intergenic
910699849 1:90062380-90062402 AAAAAACAGAATAGAAAAACTGG - Intergenic
910967172 1:92819285-92819307 AAAAAAAAAACTAGAAGGCCAGG + Intergenic
911000278 1:93157827-93157849 AAAAAACAGATTTGTAGGCCGGG + Intronic
911109491 1:94167285-94167307 AAAAAAGTGAATGGAGGGCCAGG + Intronic
911728101 1:101263741-101263763 AAAAAAAACAAAAGAGGGCCTGG - Intergenic
912329753 1:108807870-108807892 TAAAAACAGAAAAGAAGGCTGGG - Intronic
912499748 1:110114036-110114058 AAAGAACAGAGTAAAGGGCCTGG - Intergenic
912613050 1:111068004-111068026 AGAAAACAGTATGGAGGGCCAGG - Intergenic
912788084 1:112623689-112623711 AAAAAAAAGAAAAGAAAGCCCGG + Intronic
913696279 1:121328914-121328936 AAAAAACAAAACAGAGGGCTGGG + Intronic
913970603 1:143412829-143412851 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
914027184 1:143923266-143923288 ACAAAACAAAGTAGACGGCCGGG + Intergenic
914064979 1:144238440-144238462 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
914114172 1:144727914-144727936 AAAAAAAAGAAAAGTTGGCCGGG + Intergenic
914141284 1:144951141-144951163 AAAAAACAAAACAGAGGGCTGGG - Intronic
914193756 1:145432741-145432763 AACAAACAAAATAGAAGGCCGGG - Intergenic
914724903 1:150319326-150319348 ACAAAAGAGAATAGAGGGTCGGG - Intergenic
914864755 1:151417355-151417377 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
915162764 1:153931790-153931812 AAAAAAGAGCATAGACTGGCTGG - Intronic
915209043 1:154292971-154292993 AAAAACAAGAATAAATGGCCGGG + Intergenic
915351560 1:155229903-155229925 AAAAAAAAAAATTGATGGCCGGG + Intergenic
915404544 1:155649544-155649566 AAAAAATAGTATATAGGGCCAGG - Intergenic
915703189 1:157817339-157817361 ATGAAACAGAATAGAGAGCCCGG + Intronic
915926227 1:160021908-160021930 AAAAAACAGCATAGGCAGGCTGG + Intergenic
916074910 1:161194884-161194906 AAAGAACAGAATAAGAGGCCAGG + Intronic
916402137 1:164460115-164460137 AAAAAACAGAATAGAAAAACTGG + Intergenic
916803990 1:168241191-168241213 AAAAAAAAGAATAGAAGGGTGGG - Intronic
917058898 1:171015574-171015596 ACCAAACAGAATAGAAGGCAAGG - Intronic
917244510 1:172986372-172986394 AAAAAACAGAACAGAAAGACTGG - Intergenic
917308993 1:173657584-173657606 AGAAAACAGAATAGATGGAAAGG - Intronic
917402812 1:174669807-174669829 AAGAAACAGAATAGAGGGCCTGG - Intronic
917887460 1:179400606-179400628 AAAAAAAAGAGAAGATGGCCAGG + Intronic
918116905 1:181505667-181505689 AAAAAAAAAAAGAGAAGGCCAGG - Intronic
918593806 1:186269444-186269466 AAAAAAAAAAAAAAACGGCCAGG + Intergenic
918595537 1:186288603-186288625 AAAAAACAAACTAGAGGGCCAGG + Intergenic
918961176 1:191280069-191280091 AAAAAACAAAGTAGAAGGGCTGG + Intergenic
918994314 1:191736610-191736632 ACAGAACAGAATAGAGAGCCCGG - Intergenic
919101219 1:193099625-193099647 AAAGAACAGACTAGACAGGCTGG - Intronic
919560683 1:199114855-199114877 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
919696685 1:200583944-200583966 AAAAAAAAAAATAGTCGGGCCGG + Intronic
920281373 1:204846201-204846223 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
920532432 1:206713569-206713591 AAAACACAGAAGAGTAGGCCAGG + Intronic
920777453 1:208953913-208953935 CAAAAACAGTCAAGACGGCCGGG + Intergenic
920884985 1:209918890-209918912 AAAAAACAGAATAGAAAAACTGG - Intergenic
921120530 1:212132538-212132560 AAAAAACAGAGGAGACAGCCAGG + Intergenic
921197737 1:212776109-212776131 AAAAAACACAATTTACGGGCTGG - Intronic
921236066 1:213131737-213131759 AAAAAACCCAACAGATGGCCTGG - Intronic
921578994 1:216873848-216873870 AGAAAAAAGAAGAGACGGACAGG + Intronic
921673978 1:217956802-217956824 AAAGAACAGAATGTCCGGCCGGG + Intergenic
922344777 1:224687391-224687413 AAAAAATAAAAAAGTCGGCCAGG - Intronic
922608248 1:226904632-226904654 AACAAACAGAAAAGAAGTCCAGG - Intronic
922736044 1:227979270-227979292 AAAAAAGAGAAAAGAAGGCTGGG - Intergenic
923141908 1:231167615-231167637 TAAAAAAAAAAAAGACGGCCGGG - Intronic
923342756 1:233021725-233021747 AAAAAACAGAGTGGAGGGCATGG + Intronic
923675497 1:236077502-236077524 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
923798898 1:237187434-237187456 AAAAAAAAAAAAAGTCGGCCGGG - Intronic
923799459 1:237193168-237193190 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
924342197 1:243048636-243048658 AAAAAAGAGAAAAGAAGGCTGGG + Intergenic
924533003 1:244909263-244909285 AAAAAAAAAAATAGCCGGGCTGG + Intergenic
924749143 1:246869136-246869158 AAAAAACAAAACACACGGCCGGG - Intronic
924764983 1:247024066-247024088 AAAAAACATGATAAACTGCCAGG - Intergenic
1063220984 10:3967622-3967644 AAAAAAGACAAAAGATGGCCGGG - Intergenic
1063514922 10:6686451-6686473 AAAAAAAAAAGTAGACGACCGGG - Intergenic
1063674298 10:8126348-8126370 AAAAAAAAAAAAAGAAGGCCAGG - Intergenic
1063732656 10:8716675-8716697 AAAAAAGAGAAAAGACTGGCTGG - Intergenic
1064157569 10:12916436-12916458 AAAAAAAAAAATTGACAGCCTGG + Intronic
1064455293 10:15482209-15482231 AAAATTCAGAATAGGCTGCCAGG - Intergenic
1064761504 10:18626242-18626264 AAAAAACAGAAAAACTGGCCAGG + Intronic
1065181815 10:23133832-23133854 AAAAAAAAGAATAGTGGGCATGG + Intergenic
1065293193 10:24251442-24251464 AAAAAACAGATCAGAGGCCCTGG + Intronic
1066669122 10:37818209-37818231 AAAATACAGACTAGAAGGCCGGG - Intronic
1066676842 10:37896955-37896977 AAATAAGAGAATAGACGGGGAGG + Intergenic
1066683870 10:37961939-37961961 AAAAAACCTAACAGATGGCCAGG + Intronic
1066734284 10:38456907-38456929 AAAAAAGAGAAAAGAAGGCTGGG - Intergenic
1067106337 10:43369423-43369445 AAAAAATAGAACAAACAGCCTGG - Intergenic
1067612864 10:47735388-47735410 AAAAAAAAAAAGAAACGGCCTGG - Intergenic
1069386477 10:67887165-67887187 AAAAAACAGAAAAGATAGCCGGG - Intronic
1069449462 10:68504671-68504693 AAAAAACAAAAAACAAGGCCGGG - Intronic
1069483531 10:68805650-68805672 AAAAAAGAAAAAAGATGGCCGGG + Intergenic
1069529046 10:69201832-69201854 AAAAAAAAGATTTTACGGCCAGG - Intronic
1070224775 10:74491574-74491596 AAAATACAGAGTAAAAGGCCAGG - Intronic
1070623496 10:78032168-78032190 AAAAAGAAAAATAGTCGGCCGGG + Intergenic
1070936216 10:80297866-80297888 AAAAAAAAGAATACATAGCCAGG - Intergenic
1071279859 10:84091215-84091237 AAAAAAAAGAATAAAGGGGCTGG + Intergenic
1071303816 10:84279713-84279735 AATCTACAGAATAGAGGGCCAGG + Intergenic
1071372152 10:84963117-84963139 AAAAAACATAATGGATGGTCTGG - Intergenic
1071521916 10:86336837-86336859 AAAAAAAAAAATAGTGGGCCAGG - Intronic
1072136773 10:92554550-92554572 AAAAAAAAAAAAAGATGGCCAGG + Intronic
1072499915 10:96003749-96003771 TAAATACAGAATTTACGGCCCGG - Intronic
1072667343 10:97403372-97403394 AAAAAAAAGAATGGGCGGCTGGG + Intronic
1072672132 10:97438210-97438232 AAAAAAAAGAAAAAAGGGCCGGG - Intronic
1072903376 10:99429341-99429363 AAAAAAAAAAAAAGTCGGCCGGG - Intronic
1073018768 10:100423426-100423448 AAAAAAAAAAAAAGAGGGCCGGG - Intergenic
1073133266 10:101204572-101204594 AAAAAAAGAAAAAGACGGCCAGG - Intergenic
1073263161 10:102205932-102205954 AAAAAAAAGAAAAAAAGGCCAGG + Intergenic
1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1073633777 10:105176558-105176580 AAAAAACAAAAAACATGGCCAGG + Intronic
1074307746 10:112294704-112294726 AAAAACCAGATTAGAGGCCCTGG + Intronic
1074316876 10:112369157-112369179 AAAAAAAAAAAAAAACGGCCAGG + Intergenic
1074685116 10:115954805-115954827 AAAAAACAGAAAAACAGGCCGGG - Intergenic
1075179769 10:120199800-120199822 AAAAGAAAGCATAGACGACCAGG - Intergenic
1075211895 10:120498640-120498662 AAAAAAAAGAATAGAAGAGCTGG - Intronic
1075383311 10:122036486-122036508 AAAAAAAAGAATGGATTGCCAGG - Intronic
1075696514 10:124439864-124439886 GAAAAAGAGAAGAGATGGCCAGG - Intergenic
1075774433 10:124971118-124971140 AACAAACAGAATTCAAGGCCAGG - Intronic
1076266407 10:129112722-129112744 AAAAAACAGGAGAGAAGGGCTGG + Intergenic
1076832352 10:133002333-133002355 AAAAAACAGAACAAATGTCCTGG + Intergenic
1077082711 11:731935-731957 TAAAAACAGTGTAGAGGGCCGGG - Intergenic
1077816756 11:5693180-5693202 AAAAAAAAAAAAAGATGGCCAGG - Intronic
1078220285 11:9346106-9346128 AAAAAAAAAAAGAGATGGCCAGG - Intergenic
1078438922 11:11348080-11348102 AAGAAAGAGAAGAGAGGGCCGGG + Intronic
1079055807 11:17205823-17205845 ATAAAACAGAAAAAACTGCCAGG + Intronic
1079196058 11:18328213-18328235 AAAAAAAAGAATATGGGGCCAGG + Intronic
1079567352 11:21899249-21899271 AGAAAACAGAATCAAGGGCCAGG + Intergenic
1079637602 11:22764263-22764285 AAAAAGCAAGAAAGACGGCCGGG + Intronic
1080211878 11:29795510-29795532 AAAAAACAGAATAGAAAAACTGG + Intergenic
1080234762 11:30056298-30056320 AAAAAACAGAATAGAAAAACTGG - Intergenic
1081004420 11:37717138-37717160 AAAACACAAATTAGACTGCCAGG - Intergenic
1081013099 11:37840861-37840883 AAAAAATAGAGAAGACAGCCAGG - Intergenic
1081463825 11:43297988-43298010 CAAAAACAAAAAAGAAGGCCAGG + Intergenic
1081707304 11:45190441-45190463 AAAAAAAAGAATGTATGGCCGGG - Intronic
1081860162 11:46328701-46328723 AAAAAAAAGAACTGACAGCCAGG + Intergenic
1081985970 11:47304523-47304545 AAAAAATACAATAGAGGGCCAGG - Intronic
1082048936 11:47754216-47754238 AAAAAAAAGGAGAGACAGCCAGG + Intronic
1082086125 11:48051388-48051410 AAAAAACAGAAAACACGGCCAGG - Intronic
1082151858 11:48749788-48749810 AAAAAACAGAATAGAAAAACTGG - Intergenic
1082209473 11:49480670-49480692 AAAAAACAAAAAAATCGGCCGGG - Intergenic
1082217416 11:49589324-49589346 AAAAAACAGATTTGAGGGCTTGG + Intergenic
1083442130 11:62684026-62684048 AAAAAAAAAAAAAGAAGGCCAGG - Intergenic
1083573906 11:63775587-63775609 AAAATACAGGATAGCCGGCTGGG + Intergenic
1083911017 11:65710078-65710100 AAAAAAAAGAATTGAGGGCGAGG - Intergenic
1083960260 11:66011289-66011311 AAAAAAAAAAAAAGAAGGCCGGG - Intergenic
1084002111 11:66301680-66301702 CAAAAAAAGAAGAGACAGCCGGG - Intergenic
1084015980 11:66381928-66381950 AAAAAAAAGAAAAAATGGCCGGG + Intergenic
1084157785 11:67324107-67324129 AAAAAAAAGAATAGAGAGTCTGG - Intronic
1084287083 11:68139039-68139061 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
1084742352 11:71147857-71147879 TAAAAACAGAACAAAAGGCCAGG + Intronic
1085004135 11:73069013-73069035 AAAAAACAAAAAAAAAGGCCAGG + Intronic
1085089579 11:73699146-73699168 AAAAAACAGCATTATCGGCCTGG - Intronic
1085171117 11:74450762-74450784 AAGAAACAGAATAGAATTCCAGG - Intergenic
1085178678 11:74513222-74513244 AAAACACAGAATATCAGGCCGGG + Intronic
1085207557 11:74745547-74745569 AAAAAAAAAAATACACAGCCTGG + Intergenic
1085628025 11:78088568-78088590 AAAAAACAAAACAAACAGCCGGG - Intergenic
1085902472 11:80718022-80718044 AAAAAGCAGAATAAAAGGCTAGG - Intergenic
1086049738 11:82576551-82576573 AAAAAACAGAATAGAATGCAAGG - Intergenic
1086068407 11:82771279-82771301 AAAAAAAAAAATGAACGGCCGGG - Intergenic
1087502678 11:98978557-98978579 AAAAAACAGAAAAGACAGAACGG - Intergenic
1087510795 11:99090725-99090747 AAAAAAAAAAAAAAACGGCCGGG + Intronic
1087634834 11:100690143-100690165 GAAAAACAGAAAAGACAGACTGG - Intronic
1088248056 11:107838618-107838640 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
1088487349 11:110353536-110353558 AAAAAACAAAAAAAACAGCCAGG + Intergenic
1088745788 11:112803219-112803241 ATAGAACAGAATAGAGAGCCTGG + Intergenic
1088874966 11:113927852-113927874 AAAAAAGAGAAAACAGGGCCGGG - Intronic
1088924285 11:114284755-114284777 AAAAAAAAAAAAAGATGGCCGGG - Intronic
1089470505 11:118716587-118716609 AAAAAAGGGAGTAGAAGGCCGGG - Intergenic
1089507519 11:118973688-118973710 AAAAAAAAAAAAAGAAGGCCGGG - Intronic
1089522629 11:119075554-119075576 AAAAAAAAAAATACAAGGCCAGG + Intronic
1089836613 11:121376038-121376060 AAAAAACAGAAAAGAATGCATGG + Intergenic
1089940105 11:122407234-122407256 AAAAAAAAGAATGAAGGGCCGGG + Intergenic
1090010738 11:123043762-123043784 AAAAAAAAGAAAAGAGGGTCGGG + Intergenic
1090054957 11:123415050-123415072 AAAAAAAAGAAAAGGCAGCCTGG - Intergenic
1090791509 11:130094038-130094060 AAAAAAAAAAAAATACGGCCGGG - Intronic
1091248070 11:134117064-134117086 AAAAAAAACAATCCACGGCCAGG + Intronic
1091470431 12:721545-721567 AAGAAAGAAAATAGAGGGCCAGG + Intergenic
1091547108 12:1508640-1508662 AAAAAAGAGAAAACATGGCCGGG + Intergenic
1091577915 12:1756443-1756465 AAAAAAAAAAAAAGAAGGCCAGG - Intronic
1091721399 12:2816622-2816644 AAAAAAAAGAAAAAAAGGCCAGG - Intronic
1091740027 12:2954465-2954487 AAAATAAAGAATAGGAGGCCGGG + Intergenic
1091895084 12:4096082-4096104 ATAAAACAGAATAGAGAACCTGG + Intergenic
1092207653 12:6625424-6625446 AAAAAAAAAAAAAGAGGGCCGGG + Intronic
1092250861 12:6895596-6895618 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
1092348400 12:7735509-7735531 AAAAAAAAAAAAAAACGGCCAGG + Intronic
1092564112 12:9647495-9647517 AAAACACAGAAAAGACAGCTGGG - Intergenic
1092822194 12:12363302-12363324 AAAAAAAAAAAAAGCCGGCCAGG + Intronic
1093040922 12:14378391-14378413 AAAATACTGAATATAGGGCCGGG - Intronic
1093519617 12:20033125-20033147 ATAAGAAAGCATAGACGGCCGGG + Intergenic
1093614116 12:21200094-21200116 AAAAAACAAAAGTGAAGGCCGGG - Intronic
1093716582 12:22390226-22390248 TAAAAACATAATTAACGGCCAGG + Intronic
1094162976 12:27411319-27411341 TAATAACACAATAAACGGCCAGG + Intronic
1094195993 12:27750805-27750827 AAAAAAGAAAAAAGAAGGCCAGG + Intronic
1094530280 12:31268004-31268026 AAAAAAAAGAAAAAAAGGCCAGG - Intergenic
1094601397 12:31912072-31912094 AAAAAAAAGAAGAGACAGGCCGG + Intergenic
1094627547 12:32138565-32138587 GAAAAACAGAATAGACGTGTGGG - Intronic
1095138161 12:38631897-38631919 AAAATACAGAAGAGACGGGATGG + Intergenic
1095262961 12:40119061-40119083 AAAAAAAAAAATAGCCGGGCAGG + Intergenic
1095355420 12:41267441-41267463 AAAAAACAGAAGAGAGAACCAGG + Intronic
1095458699 12:42418202-42418224 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
1095972001 12:47908496-47908518 AACAAACTGAAAAGATGGCCTGG - Intronic
1096291109 12:50344045-50344067 AAAAAAAAAAATAGACTGGCTGG - Intronic
1096645979 12:53036077-53036099 AATAAAAAAAATAGAAGGCCAGG - Intronic
1096682685 12:53267322-53267344 AAAAGAAAGAAAAGAAGGCCGGG - Intergenic
1096701226 12:53384262-53384284 AAAAAAAAGAAAAGAAAGCCGGG - Intronic
1096707800 12:53433552-53433574 AAAAGAAAGAAAAGAAGGCCAGG - Intergenic
1096828523 12:54297366-54297388 AAAAAAAAAAAAAAACGGCCAGG + Intronic
1097028054 12:56072859-56072881 AAAAAAAAAAAGAGAAGGCCAGG - Intergenic
1097033735 12:56108064-56108086 ACAAAACAGATTAGAATGCCAGG + Intronic
1097049776 12:56215423-56215445 AAAGAAGAGAAGAGAGGGCCGGG + Intronic
1097569466 12:61314866-61314888 GAAAAACAGTATATAGGGCCGGG - Intergenic
1098125505 12:67288421-67288443 AAAAATCAGAAAGGACGGCCAGG - Intronic
1098334323 12:69386840-69386862 AAAAAACAGTATATAGGGCTTGG - Intronic
1099342380 12:81453812-81453834 AGAAAACATAATACATGGCCAGG + Intronic
1100399033 12:94211977-94211999 TAAAAATAGAAAAGACGGCCGGG + Intronic
1100439346 12:94601527-94601549 AAAAAACAAAAAAGAAGGCTGGG + Intronic
1100470076 12:94883479-94883501 AAAAAAAAAAACAGATGGCCAGG + Intergenic
1100531868 12:95468640-95468662 AAAAAAAAGAAAAAACGGCCAGG - Intergenic
1101400203 12:104380433-104380455 AAAAAAAAGAATGGACCTCCTGG + Intergenic
1102074929 12:110052189-110052211 AAAAAAAAAAAAAGAAGGCCGGG - Intronic
1102118898 12:110425359-110425381 AAAAAAAAAAAAAGAAGGCCAGG - Intergenic
1102215646 12:111159727-111159749 TAAAAACAGAAAAGGAGGCCAGG + Intronic
1102365935 12:112334650-112334672 AAAAAAAAAAATAGCCGGCATGG + Intronic
1102449277 12:113028744-113028766 AAAAAAAAAAATAGGGGGCCAGG + Intergenic
1103084067 12:118048222-118048244 AAAAAACAGGCTATATGGCCGGG - Intronic
1103283490 12:119780321-119780343 AAAAAAATGAAGAGCCGGCCAGG + Intronic
1103353409 12:120301776-120301798 AAATAAGAGAAAAGATGGCCGGG + Intergenic
1103479807 12:121243837-121243859 AAGAAACAGAAGTGACTGCCTGG + Intronic
1103610752 12:122122840-122122862 AAGAAAAAGAAAAGAAGGCCGGG - Intronic
1103652325 12:122442535-122442557 AAATAAATGAAAAGACGGCCGGG - Intergenic
1103691717 12:122780316-122780338 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
1103755982 12:123207556-123207578 AAAATACAGAAATGAAGGCCGGG + Intronic
1103756695 12:123213152-123213174 GAAAAACAGAATGGTCAGCCAGG - Intronic
1103781494 12:123401875-123401897 AAAAAACAGAAAACATGACCAGG - Intronic
1103995229 12:124825373-124825395 CAAAAAAAGAACAGAGGGCCAGG + Intronic
1104186819 12:126440668-126440690 AAAAAAAAGAAAAGATGGCAAGG - Intergenic
1104250620 12:127089804-127089826 CAATAACAAAATAGAAGGCCGGG + Intergenic
1104695269 12:130858776-130858798 AAAAAAAAGAAAAAAAGGCCAGG + Intergenic
1105017448 12:132794342-132794364 AAAAAAAAAAAAAGATGGCCGGG + Intronic
1105285323 13:18998634-18998656 TAAAGACAGAATGCACGGCCAGG + Intergenic
1105718063 13:23086392-23086414 TAAAAACTTAAAAGACGGCCTGG - Intergenic
1105781778 13:23711876-23711898 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
1105815031 13:24027426-24027448 AAAAAAAAGAAAAGGCAGCCAGG - Intronic
1105933832 13:25079766-25079788 AAAGAAGAGAAAAGTCGGCCAGG + Intergenic
1106370621 13:29129180-29129202 AAAAAAAAAAAAAGACTGCCAGG - Intronic
1106440993 13:29769979-29770001 TAAAGAAAGAATAGACTGCCAGG - Intronic
1106979355 13:35258457-35258479 AAAAACCAGAAAATATGGCCGGG - Intronic
1107053133 13:36074205-36074227 TAAAAACAGAGAAGACGGCCGGG + Intronic
1107338289 13:39379581-39379603 GAAAAAGACAAAAGACGGCCCGG - Intronic
1107444139 13:40455445-40455467 TAAAAACAAAACAGACAGCCAGG + Intergenic
1107502779 13:40997549-40997571 AAAAAAGAAAAAAGATGGCCGGG - Intronic
1107844955 13:44502380-44502402 AAATAACAGAAAACAAGGCCTGG - Intronic
1107908251 13:45081992-45082014 AAAAAAAAGGAGAGACAGCCGGG + Intergenic
1107939014 13:45368006-45368028 AAAATACAAAAAATACGGCCGGG - Intergenic
1108168129 13:47713187-47713209 AAAAAACAGAATAGAAAAACTGG + Intergenic
1108216655 13:48192202-48192224 AAAAAAAAAAAAAAACGGCCAGG + Intergenic
1108420103 13:50240070-50240092 AAAAAAAAAAATAGTGGGCCGGG - Intronic
1108679031 13:52763556-52763578 TAAAAACCCAATAGATGGCCGGG + Intergenic
1108740939 13:53337994-53338016 AAAAAAAAAAAAAGATGGCCTGG - Intergenic
1108775033 13:53755487-53755509 ATAAAAAAGAATAATCGGCCAGG + Intergenic
1109175791 13:59153955-59153977 AAAAAAAATAAAAAACGGCCAGG + Intergenic
1109197886 13:59398749-59398771 AAAAAGGAAAATAGAAGGCCAGG - Intergenic
1109295421 13:60524801-60524823 AAAAAACACAATTTTCGGCCAGG + Intronic
1109993086 13:70084768-70084790 AAAATATGAAATAGACGGCCCGG - Intronic
1110377505 13:74809372-74809394 AAAAAACAGAAAACACTGCTGGG - Intergenic
1110455317 13:75684538-75684560 AAAAAAAAAAAAAGCCGGCCGGG - Intronic
1111296347 13:86283843-86283865 AAAAAGTAAAATATACGGCCGGG + Intergenic
1111392105 13:87609541-87609563 AAAAGAAAGAAAAGAGGGCCAGG - Intergenic
1111437027 13:88224487-88224509 AAAAAACAGAACTGTGGGCCTGG - Intergenic
1111684491 13:91485511-91485533 AAAAAAAAGAAGGGCCGGCCGGG - Intronic
1111756395 13:92401166-92401188 AAAAAAAAAAATAGATGGCTAGG - Intronic
1111800113 13:92970726-92970748 AAAAAAAAAAAAAGACAGCCTGG - Intergenic
1111814752 13:93137663-93137685 ATAAAAAAGAATAGAAGCCCAGG - Intergenic
1112026912 13:95419594-95419616 AAAAAAAAAAATAGCTGGCCGGG + Intergenic
1112107781 13:96260611-96260633 AAAGAAAAGAAAAGAGGGCCGGG - Intronic
1112249594 13:97767532-97767554 AAAAAACTGAATAAATGGACAGG + Intergenic
1112275817 13:98017960-98017982 TAAAAACCGAATACACAGCCAGG - Intronic
1112279775 13:98052468-98052490 AAAAAGAAGAAAATACGGCCAGG - Intergenic
1112479755 13:99764273-99764295 AAAAAACTGAAGAGCCAGCCTGG - Intronic
1112552613 13:100435746-100435768 AAACAAAAGTATAGGCGGCCAGG + Intronic
1112815832 13:103272136-103272158 AAAATACAAAAGATACGGCCAGG + Intergenic
1113376983 13:109772988-109773010 AAAAAATGTAATAGGCGGCCGGG - Intronic
1113451974 13:110416971-110416993 AAAAAAAAGAAAAGTCTGCCAGG - Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114668129 14:24393200-24393222 AAAAAATAGAAAAATCGGCCGGG + Intergenic
1114874942 14:26704838-26704860 AAAAAACAGAAGAGACAAACAGG - Intergenic
1115393361 14:32878498-32878520 AAAAGAAAGATTACACGGCCGGG - Intergenic
1115525679 14:34278514-34278536 AAAAAAAAAAAAAGACCGCCGGG + Intronic
1115559542 14:34570714-34570736 AAAAAAAAAAAGAGAAGGCCAGG - Intronic
1115816638 14:37170932-37170954 AAAAAAAAAAATAGCCGGCATGG + Intronic
1116194762 14:41709972-41709994 AAAAAACTGAATACAGGCCCTGG - Intronic
1116451468 14:45071213-45071235 AAAAAACAGAAAAAGCAGCCGGG - Intronic
1116947549 14:50849585-50849607 AAAAAAAAAAAAAGAAGGCCGGG + Intergenic
1117313611 14:54553035-54553057 AAAAAAAAAAAAAGATGGCCAGG + Intergenic
1117980625 14:61339261-61339283 AAAACACAGAAGGGAAGGCCTGG - Intronic
1118299470 14:64602304-64602326 AAAAAGAAGAAAATACGGCCAGG - Intergenic
1118406131 14:65425461-65425483 AAAAAAAAAAAAAAACGGCCAGG - Intronic
1118591881 14:67407990-67408012 ATAAAATAAAATAGAGGGCCGGG + Intronic
1119026924 14:71160393-71160415 AAAAAAAAAAAAAGATGGCCAGG - Intergenic
1119111696 14:71981354-71981376 AAAAAACAGAATAGAAAAACGGG - Intronic
1119173043 14:72549223-72549245 AAAAAACAGAAAAGAAGGCAAGG - Intronic
1119249371 14:73138512-73138534 AAAAAAATAAATAGCCGGCCGGG - Intronic
1119361405 14:74053404-74053426 AAAAAATAAAAAAGTCGGCCGGG - Intronic
1119396858 14:74332648-74332670 AAAAAATAGATTAGGAGGCCAGG - Intronic
1119517282 14:75258204-75258226 AAGAAACAGAGGAGAGGGCCAGG - Intronic
1119620528 14:76128487-76128509 TAAAAACAGAAAAGTTGGCCGGG + Intergenic
1120229994 14:81831501-81831523 AAAAAACAGATTAGATGCCAAGG - Intergenic
1120959255 14:90109703-90109725 AAAAAAAAAAATAAAGGGCCAGG - Intronic
1121073731 14:91049317-91049339 AAAAAAGAGACAAGTCGGCCGGG + Intronic
1121345705 14:93134226-93134248 AAAAAAAAAAAAAGTCGGCCGGG - Intergenic
1121400400 14:93671475-93671497 AAAAAACAAAAAACAGGGCCAGG + Intronic
1121686143 14:95836650-95836672 AAAAAAAAAAAAAGAGGGCCAGG - Intergenic
1121923678 14:97907706-97907728 AAAAAACAAATTAGAAGGACTGG - Intergenic
1122872566 14:104646881-104646903 AAAAAAAAAAATAGGAGGCCGGG - Intergenic
1122948462 14:105026076-105026098 GAAAAACAGAATGGCCGGCTGGG + Intergenic
1123011520 14:105352075-105352097 ACAAAACAGATTCCACGGCCAGG - Intronic
1123587694 15:21773794-21773816 AAGAAACAGAATCCAGGGCCAGG + Intergenic
1123624332 15:22216359-22216381 AAGAAACAGAATCCAGGGCCAGG + Intergenic
1124206078 15:27722208-27722230 GAAAAATAGAATACACGACCCGG - Intergenic
1124897430 15:33789977-33789999 AAAAAAAAAAAAAGAAGGCCAGG - Intronic
1124899066 15:33805770-33805792 TAAAAACAAAAGAGAAGGCCGGG - Intronic
1125143919 15:36443532-36443554 AAAAAAAAGATTAAAAGGCCAGG + Intergenic
1125532476 15:40422576-40422598 AAAAAAAAAAAAAGTCGGCCGGG - Intronic
1125532997 15:40425955-40425977 AAAAAAAAAAATAGCCGGACTGG - Intronic
1125696751 15:41644358-41644380 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
1125908460 15:43415193-43415215 AAAAAAAAAAAAAGAAGGCCAGG - Intronic
1126139729 15:45427534-45427556 AAAAAATATAATCGCCGGCCAGG + Intergenic
1126298315 15:47166446-47166468 AAAAAACAGAATAGAAAAACTGG + Intergenic
1126312944 15:47337517-47337539 AAAAAACAGAATATATTGCATGG + Intronic
1126389541 15:48131818-48131840 GGCAAACAGAATAGAGGGCCTGG + Intronic
1126546586 15:49880815-49880837 AAAAAAAAAAAAAGCCGGCCAGG + Intronic
1126617500 15:50600139-50600161 AAAAAAGTGAATATACGACCAGG + Intronic
1126631529 15:50741366-50741388 AAAAAAAAGAGTAGATTGCCTGG + Intronic
1126649046 15:50903465-50903487 AAAAAAGAAAAGAGAAGGCCGGG - Intergenic
1126650897 15:50920406-50920428 AAAAAAAAAAAAAGAAGGCCGGG - Intronic
1126762888 15:51985661-51985683 AAAAAACAAAAAACCCGGCCAGG + Intronic
1126828670 15:52576984-52577006 AAAAAACAGATTATAGGGCTGGG - Intergenic
1127177344 15:56374278-56374300 AAAAAACAGAATAGAAAACTGGG + Intronic
1127413640 15:58734488-58734510 AAAAAACTGAAAAGACAGCCTGG + Intronic
1127675771 15:61237149-61237171 AAAAGACAGCATAGGAGGCCAGG - Intergenic
1128068396 15:64778049-64778071 TAAAAAAAGAAAAGAAGGCCGGG - Intergenic
1128070435 15:64792731-64792753 AAAATACAGCATACAGGGCCAGG + Intergenic
1128088757 15:64904832-64904854 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
1128467122 15:67922212-67922234 AAAAAACAAAAAAAAAGGCCGGG - Intergenic
1128829507 15:70754325-70754347 AAAAAACAGAATAGTTGTACGGG - Intronic
1128913707 15:71540429-71540451 AAAAAAAAAAAAAGGCGGCCAGG - Intronic
1128993484 15:72279748-72279770 CAAAAGCAGAAAAGGCGGCCGGG - Intronic
1129504931 15:76073224-76073246 AAAAAAAAAAAAAGAAGGCCGGG - Intronic
1129553651 15:76481024-76481046 AAAAAGTAGAATAGTGGGCCGGG - Intronic
1130157595 15:81365375-81365397 AAGAAACAGAAAAAAGGGCCGGG + Intronic
1130659937 15:85823221-85823243 AAAAAACAAAAAAAAAGGCCAGG - Intergenic
1131040894 15:89265815-89265837 AAAAAACAAAAAATCCGGCCAGG - Intronic
1131098764 15:89672127-89672149 AAAGAAGAGCATGGACGGCCTGG - Intronic
1131185134 15:90267396-90267418 TAAAAAAAGAATTGAGGGCCAGG - Intronic
1131480869 15:92780599-92780621 AAAAAATACAAAAGGCGGCCAGG - Intronic
1131632439 15:94193569-94193591 AAAAAACAAAATCTGCGGCCCGG + Intergenic
1131717941 15:95133756-95133778 ATTAAACAGAAAAGAGGGCCGGG + Intergenic
1132015235 15:98309469-98309491 AAAAAAAAGAAGAGGAGGCCGGG - Intergenic
1132143522 15:99413429-99413451 AAAAAAAAGAAAAAAAGGCCGGG - Intergenic
1132318483 15:100908142-100908164 AGAAAAAAGAAGAGAGGGCCAGG - Intronic
1132503562 16:295968-295990 AAAAAAAAGACTCGAAGGCCAGG + Intronic
1132542357 16:516579-516601 AACGAACAGAAAAGAGGGCCGGG + Intronic
1132735267 16:1382795-1382817 TAAAAACACAAAAAACGGCCAGG + Intronic
1132780622 16:1622741-1622763 AAAAAAAAAAGTAGACTGCCGGG - Intronic
1133281158 16:4666122-4666144 AAAAAAGAAAAGAGATGGCCAGG - Intronic
1133465293 16:6021357-6021379 AAAAAAAAGATGAGAGGGCCTGG + Intronic
1133668608 16:7995447-7995469 AAAAAAAAAAAAAGTCGGCCAGG - Intergenic
1133701998 16:8317598-8317620 AAAAAAAAGAAAACATGGCCAGG - Intergenic
1133789152 16:8995876-8995898 AAAATACAAAATAGTCAGCCAGG - Intergenic
1133820317 16:9230165-9230187 ACAAAACAGAATAGAGAACCCGG - Intergenic
1133881713 16:9788551-9788573 AAAGAAGAGAAAAGAAGGCCAGG - Intronic
1134160524 16:11884769-11884791 AAAAAAAAAAAAAGAAGGCCAGG + Intronic
1134786696 16:16951230-16951252 AAAAAAAAAAAAAGAAGGCCGGG - Intergenic
1135013296 16:18903118-18903140 AAAAAACAAAATTTATGGCCGGG - Intronic
1135034365 16:19064652-19064674 AAAAAAAAAAAAACACGGCCGGG - Intergenic
1135277841 16:21128695-21128717 AAAAAAAAAAATAGACGCGCTGG + Intronic
1135320226 16:21490714-21490736 AAAAAACAAAATTTATGGCCGGG - Intergenic
1135373061 16:21922204-21922226 AAAAAACAAAATTTATGGCCGGG - Intergenic
1135430954 16:22382971-22382993 AAAAAATAAAATAAAAGGCCAGG - Intronic
1135438728 16:22448498-22448520 AAAAAACAAAATTTATGGCCGGG + Intergenic
1135512637 16:23100475-23100497 ACAAAGCAGAATAGTGGGCCGGG + Intronic
1135639181 16:24105351-24105373 AAAAAAAAGAAAAAAAGGCCAGG - Intronic
1135950748 16:26911870-26911892 AAAAATGAGAAGAGATGGCCAGG + Intergenic
1136218483 16:28811846-28811868 AAAAAAAAAAACAAACGGCCAGG - Intergenic
1136330453 16:29572412-29572434 AAAAAACAAAATTTATGGCCGGG - Intergenic
1136445081 16:30312132-30312154 AAAAAACAAAATTTATGGCCGGG - Intergenic
1136463228 16:30424879-30424901 AAAAAATAGAAAAGATGGTCTGG - Intronic
1136474568 16:30504719-30504741 AAAAAAAAAAAGAGCCGGCCGGG + Intronic
1136487130 16:30580648-30580670 AAAAAAAAAAAAAAACGGCCAGG - Exonic
1136523565 16:30813555-30813577 AAAAAAAAGAAAAGAGGGCCAGG + Intergenic
1136532966 16:30882241-30882263 AGAACACAGAATAAATGGCCGGG - Intronic
1136917279 16:34217939-34217961 AAAAAACAGAATAGAAAAACAGG - Intergenic
1137266959 16:46877013-46877035 AAAAAAAAAAAAAGAAGGCCGGG + Intergenic
1138679329 16:58673657-58673679 AAAAAAAAAAAAAAACGGCCAGG - Intronic
1139071566 16:63388987-63389009 AAAAAACAGAATAGAAAAACTGG + Intergenic
1139349152 16:66324566-66324588 AAAAAAAAAAAAAGGCGGCCGGG - Intergenic
1139604055 16:68005340-68005362 AAAAAACAAAAAACAGGGCCAGG - Intronic
1139716178 16:68814928-68814950 AAAAAAAAAAAAAGATGGCCGGG + Intronic
1139798950 16:69505520-69505542 AAAAAAAAAAAAAGGCGGCCAGG + Intergenic
1139808960 16:69596422-69596444 TAAAAAAAGAAAAGAAGGCCGGG + Intronic
1139876473 16:70150082-70150104 AAAAAAAAAAAAAGCCGGCCGGG - Intronic
1139918733 16:70445266-70445288 AAAAAAAAAAATTGAAGGCCGGG - Intergenic
1140079114 16:71727838-71727860 AAAACACAGAGTTGACAGCCAGG + Intergenic
1140346118 16:74214668-74214690 AAAAAACAGATTACTTGGCCAGG - Intergenic
1140358732 16:74327397-74327419 AAAAAATAGAATTATCGGCCGGG + Intergenic
1140382856 16:74506039-74506061 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
1140402295 16:74681496-74681518 ATAAAACACAAGACACGGCCGGG + Intronic
1140424823 16:74852141-74852163 AAAAAAAAGAAAAGACTGGCCGG + Intergenic
1140426642 16:74866718-74866740 AAAAACCTGAAAAGATGGCCAGG + Intergenic
1140471852 16:75219677-75219699 AAAAAATAGAAAACACGGCTGGG - Intronic
1140630322 16:76844656-76844678 AAAAAAAAGAAAAAACTGCCAGG - Intergenic
1140921621 16:79543656-79543678 AAGAAAAAGAAAAGAGGGCCTGG - Intergenic
1141077401 16:81019957-81019979 GAAAAGCAGAAAAGACTGCCAGG + Intronic
1141084811 16:81085859-81085881 CAAAAACAAAAAAAACGGCCGGG + Intronic
1141087177 16:81104370-81104392 AAAAAAAAAAAAAGAAGGCCGGG + Intergenic
1141101949 16:81203892-81203914 ACAAAACAGAATAGAGTGCTCGG + Intergenic
1141136295 16:81467874-81467896 AAAAAAAAAAAAAGAAGGCCAGG - Intronic
1141322033 16:83020250-83020272 AATAACCAGAATAAAAGGCCAGG - Intronic
1141566898 16:84908671-84908693 AAAAAAAAAAAAAGACAGCCAGG - Exonic
1141674687 16:85511533-85511555 AAAAAAAAAAAAAGATGGCCTGG + Intergenic
1141730174 16:85817011-85817033 TAAAAAAATAATAGGCGGCCAGG - Intergenic
1142047643 16:87935875-87935897 AAAAAAGAAAAAAGAGGGCCGGG + Intronic
1142301492 16:89261151-89261173 AAAAAAAAGAAAAGTCGGCCGGG + Intergenic
1142326033 16:89415247-89415269 AAAAAAAAGAATAGCTGGCCAGG - Intronic
1142391362 16:89802696-89802718 AAAAAAAAGAATAGCTGGCCGGG - Intronic
1142663517 17:1447910-1447932 AAAAAAGGGAAAAGAGGGCCGGG - Intronic
1142838244 17:2605665-2605687 AAAAATTAGAAAAGACTGCCTGG - Intronic
1142861428 17:2764425-2764447 AAAAATAAAAATAGAAGGCCAGG + Intergenic
1142965964 17:3581589-3581611 AAAAATCACAATAGAAGGCTGGG + Intronic
1143079799 17:4373022-4373044 AAAAAAAAAAAAAAACGGCCAGG - Intergenic
1143177033 17:4961458-4961480 AAAAAAAAAAAGAGATGGCCGGG + Intronic
1143312885 17:6007787-6007809 AAAAAACACACTAGGAGGCCAGG - Intronic
1143365824 17:6407909-6407931 AAAAAAAAGAGTAGACCCCCGGG + Intronic
1143453118 17:7048500-7048522 TAAAAACAAAAGAGAAGGCCGGG + Intergenic
1143497371 17:7320123-7320145 AAAAAAAAGAAAAAAAGGCCAGG - Intronic
1143634649 17:8157472-8157494 AAAAAAAAAAAACGACGGCCGGG + Intronic
1144067221 17:11635474-11635496 AAAAAATTGAAAAGAGGGCCGGG - Intronic
1144328996 17:14207474-14207496 AAGAAACAGAATAGAGGGTGGGG - Exonic
1144526287 17:15993171-15993193 TAAAAATAGAATAAAAGGCCAGG - Intronic
1144566772 17:16365901-16365923 CAAAAACAGATGAGACGGCAGGG - Intergenic
1144608153 17:16686075-16686097 AAAAAACAAAAAAAACAGCCGGG - Intergenic
1144683176 17:17208605-17208627 AAAAAAAAAAAAAGAAGGCCGGG - Intronic
1145034100 17:19528177-19528199 TAAAAAGAGAATCGAGGGCCGGG + Intronic
1145092180 17:19995112-19995134 AAAAAAAAAAAAAGAGGGCCGGG - Intergenic
1145098909 17:20057144-20057166 AAAAAACAGAAAGGTTGGCCGGG + Intronic
1145232856 17:21187328-21187350 AAAAAACAAAACAGAAGGCCGGG + Intronic
1145283866 17:21489212-21489234 AAAAAAAAAAATAGACTGCAAGG - Intergenic
1145292233 17:21557221-21557243 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1145838257 17:27971166-27971188 AAAAAAAAAAAAAGAAGGCCGGG + Intergenic
1145914584 17:28564269-28564291 AAAAAACAAAATACACAGGCTGG + Intronic
1146143724 17:30391123-30391145 AAAAAAAAAAAAAGGCGGCCAGG - Intronic
1146396293 17:32470298-32470320 AAAAAACAGAAACAAAGGCCAGG - Intronic
1146597235 17:34180163-34180185 ATGGAACAGAATAGAGGGCCCGG + Intergenic
1147089764 17:38088311-38088333 TAAGAACAGCATACACGGCCGGG - Intergenic
1147255545 17:39179291-39179313 AAAAAAAAAAAAAGAGGGCCGGG + Intronic
1147647827 17:42044319-42044341 AAAAAAAAAAAAAGACGGCCGGG + Intronic
1147962900 17:44178466-44178488 AAAGAAAAGAAAAGAGGGCCAGG - Exonic
1147964061 17:44184062-44184084 AAAAATCAGGATACAAGGCCAGG + Intergenic
1148013846 17:44506811-44506833 AAAAAAAAAATTAGCCGGCCAGG + Intergenic
1148102477 17:45100884-45100906 AAAAAAAAAAAAAGAAGGCCAGG + Intronic
1148137683 17:45305389-45305411 AAAAAAAAAAAAAAACGGCCGGG - Intronic
1148380524 17:47193561-47193583 AAAAAACAGAGCAGTAGGCCAGG - Intergenic
1148413114 17:47484773-47484795 AAAAAAAAGAAGTTACGGCCGGG + Intergenic
1148504188 17:48114448-48114470 AAAAAAAAAAAAAGAAGGCCTGG - Intronic
1148504249 17:48114824-48114846 AAAATACAAAATAGTCAGCCAGG - Intronic
1148926423 17:51089970-51089992 AAAAAATAGTATATATGGCCGGG - Intronic
1148972603 17:51497636-51497658 ACCAAACAGAATAGAGGGCCAGG - Intergenic
1149502525 17:57165032-57165054 AAAAAACAGAACAAACCGGCTGG + Intergenic
1149617137 17:58010151-58010173 AAAAAAAAAAAAAGCCGGCCAGG - Intergenic
1149675007 17:58451955-58451977 AAAAAAAAAAAAGGACGGCCAGG + Intronic
1149786073 17:59436175-59436197 AAAAAATAGAATGGTGGGCCAGG - Intergenic
1150152214 17:62819411-62819433 AAAAATCAGGATATGCGGCCGGG - Intergenic
1150216434 17:63473517-63473539 AAGAAAATGAAAAGACGGCCAGG - Intergenic
1150354119 17:64468787-64468809 AAAAAAATGAAAAGATGGCCGGG + Intergenic
1150745371 17:67812492-67812514 AAAAATAAAAATATACGGCCAGG - Intergenic
1151203482 17:72487602-72487624 AAAAAAAAGAAAAAACTGCCTGG + Intergenic
1151630202 17:75305682-75305704 AAAAAAAAAAAAAAACGGCCAGG - Intergenic
1151704713 17:75760906-75760928 AAAAAATAAAAAAGATGGCCAGG + Intronic
1151715603 17:75829586-75829608 AAAAAAAAAAAAAGAGGGCCAGG - Intronic
1151800245 17:76375054-76375076 AAAAAACAAAATTGAGGGGCTGG - Intronic
1151813616 17:76459908-76459930 AGCAGACAGATTAGACGGCCTGG - Intronic
1152440734 17:80307843-80307865 AAAAAAAAAAACAGACGGCCAGG - Intronic
1152543050 17:80986636-80986658 AAAAAAAAAAAAAGATGGCCAGG - Intergenic
1152648017 17:81479106-81479128 AAAAAATAAAATAAAAGGCCGGG - Intergenic
1152826240 17:82466986-82467008 AAAAAAAAAAAAAGAAGGCCAGG - Intronic
1203161233 17_GL000205v2_random:52413-52435 ATGAAACAGAATAGACATCCTGG - Intergenic
1153023884 18:656874-656896 AAAAAAAAAAAAAGACCGCCAGG + Intronic
1153023893 18:656923-656945 AAAAAAAAAAAAAGACCGCCAGG - Intronic
1153114198 18:1634680-1634702 AAGAAACAGAATAGAAAGTCCGG + Intergenic
1153242055 18:3039900-3039922 AAAAAACAGATGAGAAGGGCCGG - Intergenic
1153631770 18:7077498-7077520 AAAAATAAGCATAGACAGCCAGG - Intronic
1154362681 18:13677058-13677080 AAAAAAAAAAATAGAGGGACAGG - Intronic
1154396295 18:13992972-13992994 AACAAACAGCAGAGAAGGCCGGG - Intergenic
1154401757 18:14044884-14044906 AAAAAATAGAATGGGAGGCCGGG - Intergenic
1154939275 18:21094749-21094771 AAAAAAAAAAAAAGATGGCCAGG + Intronic
1154949846 18:21199003-21199025 AAAAAAAAAAAAAGATGGCCGGG - Intergenic
1155675206 18:28421634-28421656 AAAAAACAGAATAGAAAAACTGG - Intergenic
1155746911 18:29365880-29365902 AAAAAACCAACTTGACGGCCGGG - Intergenic
1155875140 18:31076639-31076661 AAAAAAGAGAATAGACAGAATGG + Intronic
1155987572 18:32246175-32246197 AAAAAATAAAATATGCGGCCGGG - Intronic
1156097447 18:33552067-33552089 AAAAAAAAAAATAGATGTCCAGG + Intergenic
1156330270 18:36115144-36115166 AAAAAACTGAAGAGGGGGCCGGG + Intronic
1157015612 18:43709112-43709134 AATAAACTGGATAGACTGCCTGG - Intergenic
1157249889 18:46085634-46085656 AAAAAACAGAATACAGGGCCGGG + Intronic
1157697931 18:49738491-49738513 AAAAAACAAAATTAGCGGCCAGG - Intergenic
1158159456 18:54464168-54464190 AAATAAAAGAATATATGGCCTGG - Intergenic
1158364613 18:56719266-56719288 AAAAAACAGAATTGCTGGCCGGG + Intronic
1159048362 18:63392741-63392763 AAAAAACAAAAAATAGGGCCAGG - Intronic
1159151164 18:64525521-64525543 AGAAAACACAACAGAAGGCCAGG + Intergenic
1159963701 18:74576161-74576183 AAAAAAAAAATTATACGGCCAGG - Intronic
1160312514 18:77809205-77809227 AAAGAACAAAATAAACAGCCTGG - Intergenic
1160598728 18:79996113-79996135 AAAAAAAAAAAAAAACGGCCAGG + Intronic
1160657071 19:278763-278785 AAAAAACAAAGTACATGGCCGGG + Intergenic
1160712251 19:557664-557686 AAAAAAGAGAAAAAAAGGCCAGG - Intergenic
1160787966 19:910326-910348 AAAAAAAAAAATAGCCGGCATGG + Intronic
1160977290 19:1799468-1799490 AAAAAAAAAAAAAGTCGGCCGGG + Intronic
1161148258 19:2692637-2692659 AAAAAAAAAAAAAGAAGGCCAGG + Intronic
1161177177 19:2851289-2851311 AAAAAAAAAAATTCACGGCCAGG - Intronic
1161191997 19:2962829-2962851 AAAAAAAAAAAAAGAAGGCCAGG - Intergenic
1161197101 19:2993048-2993070 AAAAAACAGAATAATTAGCCAGG + Intronic
1161215540 19:3093603-3093625 AAAAAAAAAAAAAGAGGGCCGGG - Intergenic
1161373879 19:3928948-3928970 AAAAAACAGAAAAGAAGGCCGGG + Intergenic
1161376212 19:3940348-3940370 AAAAAAAAAAAAAGGCGGCCAGG + Intronic
1161441679 19:4295263-4295285 AAAAAAAAAAAAAGAAGGCCAGG + Intronic
1161467393 19:4438983-4439005 AAAAAAAAGCATAGATGGCTGGG + Intronic
1161506423 19:4646281-4646303 AAAAAAAAAAAAAGTCGGCCGGG - Intronic
1161649668 19:5476703-5476725 AAAAAAAAGGAGAGGCGGCCGGG + Intergenic
1161677544 19:5660716-5660738 AAAAAAAAAAAAAGACAGCCTGG + Intronic
1161792025 19:6365819-6365841 AAAAAAAAAAAAAGGCGGCCAGG + Intronic
1161828003 19:6582334-6582356 AAAAAAAAGATTTGACTGCCTGG - Intergenic
1161898994 19:7103855-7103877 CAAAAAAAGAATACAAGGCCGGG + Intergenic
1161918905 19:7251554-7251576 AAAAAAAAAAATTGATGGCCGGG - Intronic
1161944635 19:7427648-7427670 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
1162289115 19:9765375-9765397 AAAAAACAAAAAAGTAGGCCAGG + Intronic
1162343993 19:10109252-10109274 AAAAAAAAGTAAAGAAGGCCGGG - Intronic
1162355082 19:10178259-10178281 AAAAAATAAAATAAAGGGCCAGG + Intronic
1162370526 19:10276248-10276270 AAACAAAAGAATTGATGGCCGGG + Intronic
1162455214 19:10779947-10779969 AAAAAACACAAAAGAAGGCTGGG - Intronic
1162559674 19:11409183-11409205 AAAGAAAAGAAAAGAAGGCCGGG + Intronic
1162590297 19:11586999-11587021 AAAAGTCAGAGGAGACGGCCAGG - Intronic
1162645816 19:12049474-12049496 AAAAAAAAGAATAACAGGCCGGG + Intronic
1162714852 19:12624149-12624171 AAAAAAAAAAAAAGAAGGCCAGG - Intronic
1162725301 19:12686814-12686836 TAAAAAAAGAAAAGAAGGCCAGG + Intergenic
1162750776 19:12828100-12828122 AAAAAAAAGAAAAAAAGGCCGGG + Intronic
1162862028 19:13513361-13513383 AAAAATCACCATAGTCGGCCGGG + Intronic
1162900512 19:13792910-13792932 AAAAAACAGAAAACGAGGCCGGG - Intergenic
1163167031 19:15505671-15505693 AAAAAATAAAATAAAAGGCCAGG + Intergenic
1163318895 19:16560564-16560586 AAAAAACCTAACAGACAGCCGGG + Intronic
1163359219 19:16835219-16835241 AAAAAAAAAAAAAGATGGCCAGG - Intronic
1163471864 19:17501814-17501836 AAAAAAAAGAATACCTGGCCGGG + Intronic
1163483970 19:17575672-17575694 AAAAAGCAAAAAAGAAGGCCGGG - Intronic
1163490322 19:17614003-17614025 CAAAAACAAAAAAGAAGGCCAGG - Intronic
1163531714 19:17853858-17853880 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
1163563781 19:18037276-18037298 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
1163604876 19:18268666-18268688 AAAATACAGAAAAGTAGGCCAGG + Intronic
1163707649 19:18824888-18824910 AGAAAAGAAAATTGACGGCCAGG - Intergenic
1163718209 19:18884700-18884722 AAAAAAAAAAAAAGACGGCTGGG - Intronic
1163855113 19:19695510-19695532 TAAAAAAAGAATAGCCGGCCAGG - Intergenic
1164088405 19:21925493-21925515 TAAAACCACAATTGACGGCCGGG + Intergenic
1164253684 19:23508377-23508399 AAATAACAGGATACAGGGCCAGG + Intergenic
1164278832 19:23750544-23750566 AAAAAACACACTAGTAGGCCAGG + Intronic
1164313861 19:24069620-24069642 AAAAAAAAGAATATTCTGCCAGG + Intronic
1164498123 19:28787999-28788021 AAAAAAAAAAATGGAGGGCCGGG + Intergenic
1164987961 19:32662745-32662767 AAAAAACAAAAAAAAAGGCCAGG + Intronic
1165000046 19:32753496-32753518 AAAAAAAAGAATAAGAGGCCAGG - Intronic
1165088439 19:33368198-33368220 AAAGAACAGATTAGTCAGCCAGG + Intergenic
1165212470 19:34246934-34246956 AAAAAAAAAAAAAGAAGGCCCGG - Intergenic
1165358868 19:35321167-35321189 AAAAATAAAAATATACGGCCAGG + Intronic
1165429383 19:35763799-35763821 AAAAAAAAAAAAAGAAGGCCGGG - Intronic
1165456971 19:35917811-35917833 AAAAAAAAGAATTAATGGCCGGG + Intergenic
1165465538 19:35972566-35972588 AAAAAAAAAAAAAGAAGGCCGGG + Intergenic
1165553986 19:36613733-36613755 AAAAAGCAAAATATACAGCCGGG - Intronic
1165594657 19:37002469-37002491 AAAAAAAAGTAAAGTCGGCCGGG + Intergenic
1165752094 19:38266378-38266400 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
1165885158 19:39072794-39072816 AAAAAACAAAATACATGGCCAGG + Intergenic
1165911864 19:39234032-39234054 AAAAAAAATAATAGTAGGCCAGG + Intergenic
1166009661 19:39933112-39933134 TAAAAACAGAAAGAACGGCCAGG - Intronic
1166061808 19:40330531-40330553 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
1166184448 19:41130760-41130782 AAAAAAAAGAAAAGAGGGGCTGG - Intergenic
1166216375 19:41338197-41338219 AAAAAACAAAGAATACGGCCGGG + Intronic
1166363250 19:42265001-42265023 AAAAAAAAGAAGAAATGGCCGGG - Intergenic
1166442302 19:42825480-42825502 AGAAAAGAGAAAAGACGGGCAGG - Intronic
1166568319 19:43778532-43778554 AGAAAAGACAATAGAGGGCCGGG - Intronic
1166577015 19:43851419-43851441 AAAAAAAAAAAAAGACGGCCGGG + Exonic
1166777161 19:45320082-45320104 AAAAAAAAGAAGAAAAGGCCGGG - Intronic
1166839229 19:45686414-45686436 AAGAAACAGAAAAAAGGGCCGGG - Intergenic
1166984472 19:46651374-46651396 AAAATACAGGATAAATGGCCAGG - Intronic
1167017936 19:46853642-46853664 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
1167075786 19:47248204-47248226 AAAAAAAAAAAAAGAGGGCCAGG - Intergenic
1167088089 19:47324224-47324246 GAAAAACAGACTGGACAGCCAGG - Intergenic
1167129824 19:47577154-47577176 AAGAAAAAGAAAAGAAGGCCAGG - Intergenic
1167164349 19:47788297-47788319 AAAAAAAAGAAAAGCAGGCCGGG - Intergenic
1167177658 19:47876777-47876799 AAAAAAAAAAAAAGATGGCCGGG + Intronic
1167245829 19:48372655-48372677 AAAAAACAGACGAGAGGGACAGG + Intronic
1167298878 19:48667864-48667886 AAAAAAAGAAATAGAGGGCCGGG + Intronic
1167302657 19:48687735-48687757 AAAAAACAGAAAGTAGGGCCGGG - Intergenic
1167347240 19:48954358-48954380 AACAAACAGAAAAGCAGGCCTGG + Intergenic
1167620755 19:50559137-50559159 AAGAAAAAGAAAAGAGGGCCGGG + Intronic
1167897709 19:52594487-52594509 AAAAAACAGAACAAAAGGCCAGG - Intronic
1168219336 19:54949278-54949300 AAAAAAAAAAAAAGATGGCCAGG + Intronic
1168286109 19:55334622-55334644 AAAAAACAGAAAAGTAGGTCGGG - Intergenic
1168534787 19:57159805-57159827 AAAAAAAAAATTAGCCGGCCAGG + Intronic
1168621940 19:57886581-57886603 AACAAAAAAAAAAGACGGCCAGG + Intronic
925615997 2:5744918-5744940 ACAAAACAAATTAGCCGGCCGGG - Intergenic
925630274 2:5884666-5884688 AAAAAACAGAGAACATGGCCAGG - Intergenic
925980485 2:9173064-9173086 AAAGAAAAGAAAAGAAGGCCGGG + Intergenic
926287602 2:11502210-11502232 AAAAAAAAAAAAAGAGGGCCAGG - Intergenic
926398073 2:12466770-12466792 GAAAAAAATAATTGACGGCCGGG - Intergenic
926538892 2:14150320-14150342 AAAAAAAAGATAAGACTGCCAGG + Intergenic
926665144 2:15513583-15513605 AAAATACAAAATAAATGGCCTGG + Intronic
927396610 2:22658530-22658552 ATAAAACAGAATAGAAAGCCTGG + Intergenic
927475100 2:23408072-23408094 ATGAAACAGAATAAACAGCCTGG - Intronic
927628297 2:24747488-24747510 AAAAAATAGAATAGTTAGCCGGG - Intronic
927790793 2:26007893-26007915 AAAAAAAAAAATAGAGGGCTGGG - Intergenic
927896769 2:26787508-26787530 AAAAAACCAAAAAGCCGGCCGGG - Intronic
928026367 2:27742695-27742717 AAAAAACACAAACAACGGCCAGG - Intergenic
928575172 2:32647234-32647256 AAAACACATAATACAAGGCCAGG - Intronic
928653348 2:33424673-33424695 AAAAAAAAGAATTAATGGCCAGG - Intergenic
928682676 2:33718333-33718355 AAAAAAAAAAATAGGCGGCTGGG + Intergenic
929523857 2:42681223-42681245 AAGACAAAGAATAGATGGCCAGG - Intronic
930211213 2:48639361-48639383 ATGGAACAGAATAGACAGCCAGG + Intronic
930479758 2:51932228-51932250 AAAAAAAAGAAAAGAAGCCCGGG - Intergenic
930888599 2:56356916-56356938 AAAAAACAAAAAAGTAGGCCAGG + Intronic
931295434 2:60919718-60919740 AAAAAACAGAAAAATTGGCCAGG - Intronic
931367471 2:61631351-61631373 AAAAAACAGAAGAGTTAGCCAGG - Intergenic
931449700 2:62358297-62358319 AAAAAATAGAAGAGATTGCCAGG - Intergenic
931537167 2:63291836-63291858 AAGAAAAAGAAAAGAAGGCCGGG + Intronic
931654952 2:64502470-64502492 AAAAAACAAAATTGTGGGCCGGG + Intergenic
931764415 2:65442211-65442233 AGAAAAAGGAATAGAAGGCCGGG + Intergenic
931958315 2:67452781-67452803 AAAAAAAAGAATAACCGGCCGGG - Intergenic
932034617 2:68230286-68230308 AGAAAACAGAAATGAAGGCCGGG - Intronic
932236160 2:70122804-70122826 AAAAAAAAGAAAAGAAGGCATGG - Intergenic
932253403 2:70263952-70263974 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
932339393 2:70951610-70951632 AAAAAATAGAACACTCGGCCAGG + Intronic
932557664 2:72839628-72839650 AAAAAACTGAAATAACGGCCGGG - Intergenic
932609806 2:73190483-73190505 AAAAAACAAAAAAAAAGGCCGGG + Intergenic
932815644 2:74859389-74859411 AAAAAAATAAATAGAAGGCCGGG + Intronic
932824426 2:74926653-74926675 AAAAAAAAAAATACAGGGCCGGG - Intergenic
933732141 2:85465077-85465099 AAAAAAGAAAAAAGAAGGCCAGG - Intergenic
933838617 2:86266710-86266732 AAAAAACAAACTAAAAGGCCAGG + Intronic
933844364 2:86313688-86313710 AAAATACAGAATCAAGGGCCAGG + Intronic
934058717 2:88274431-88274453 AAAAAAAAGAAAAGAAAGCCGGG - Intergenic
934285614 2:91648115-91648137 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
934675091 2:96244175-96244197 AAAAAAAAGAAAAAAAGGCCAGG - Intergenic
934740426 2:96717542-96717564 AAAAAAAAAAAAGGACGGCCAGG + Intronic
935076484 2:99749843-99749865 GAAAAACAGAATAGACAGTCCGG + Intronic
935172044 2:100617759-100617781 AAAAAAAAAAATAGCCGGGCGGG - Intergenic
935219924 2:101003302-101003324 ACAAAACAAAACAGATGGCCAGG - Intronic
935343616 2:102082632-102082654 ACAAAACAGAACAAACGCCCTGG + Intronic
935484399 2:103635332-103635354 TAAAAATAGAATAGGGGGCCGGG - Intergenic
935883203 2:107587550-107587572 TAAAAACAGAAGAGAATGCCAGG - Intergenic
936590657 2:113800676-113800698 AAAAAATTAAAAAGACGGCCGGG - Intergenic
936827336 2:116598392-116598414 AAAAAAAACAAAACACGGCCAGG - Intergenic
937204953 2:120230110-120230132 AGAAAACAGAATAAAAGGCTGGG - Intergenic
937352089 2:121172381-121172403 AAAGAAGAGAATCGACAGCCAGG - Intergenic
939051850 2:137316778-137316800 AAAAAAAAGAAAAGGCGACCAGG + Intronic
939462676 2:142516961-142516983 AAAAAACAGAATAGACTTCAGGG - Intergenic
940306848 2:152236157-152236179 AAAAAAAAAAAAAGACAGCCAGG - Intergenic
940590672 2:155721457-155721479 AAACAAAAGACTAGACAGCCAGG + Intergenic
940690925 2:156919545-156919567 AAAAAACAAATAAGAAGGCCGGG - Intergenic
940782461 2:157947109-157947131 AAAAAACAGAAGTGAGTGCCAGG - Intronic
941923138 2:170871373-170871395 AAAAAAAAAAAAATACGGCCAGG - Intergenic
942140300 2:172970746-172970768 AAAAAACAGAATAGAGCTTCAGG + Intronic
942164624 2:173230125-173230147 TAAAAACAGAAAAAAAGGCCAGG - Intronic
942175985 2:173335127-173335149 AAAAAACAAAACAGTTGGCCAGG - Intergenic
942344086 2:174983532-174983554 AAAAAATAAGCTAGACGGCCGGG + Intronic
943338252 2:186645412-186645434 AATAAACAGAAAAAAAGGCCAGG + Intronic
943437091 2:187879389-187879411 AAAAAACAGAAGAAACGGAGAGG + Intergenic
944300495 2:198119448-198119470 AAGAAACAGAACTGAGGGCCTGG - Intronic
944556743 2:200894701-200894723 AAAAAAAAAAAAAGAAGGCCAGG - Intronic
944685167 2:202111529-202111551 AAAAAAAAGGATAGAATGCCAGG + Intronic
944807935 2:203300899-203300921 AAAAAAAAAAAAAAACGGCCAGG + Intronic
945176817 2:207051671-207051693 ATAAAACAGAATGGCAGGCCAGG + Intergenic
945233865 2:207616547-207616569 AAAAAACAGAATATCCGGCTGGG + Intronic
945291745 2:208134069-208134091 AAAAAAAAAAAAAGAAGGCCTGG - Intergenic
945327465 2:208499220-208499242 AAAAAAGGGGATAGATGGCCAGG + Intronic
945940933 2:215949262-215949284 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
946237975 2:218336774-218336796 AAAAAAAAGAATTGAAGGCCAGG - Intronic
946693586 2:222329625-222329647 AAAAAAAAAAATAGAGAGCCCGG - Intergenic
947000789 2:225453970-225453992 AAAAAAATTAATAGATGGCCAGG - Intronic
947027770 2:225758190-225758212 AAAAAAAAAAAAAGAAGGCCGGG + Intergenic
947041422 2:225925282-225925304 AAGTAACAGCATAGACTGCCAGG - Intergenic
947041682 2:225929025-225929047 TACAAACAGAATACACGCCCAGG + Intergenic
947108162 2:226689713-226689735 AAAAAACAAAATAAATGGCAGGG + Intergenic
947192828 2:227526701-227526723 AAAAAACACAAAAAACAGCCGGG - Intronic
947385117 2:229583442-229583464 AAAAAACAGAATAGCTGTACGGG + Intronic
947486757 2:230557340-230557362 AAAAAAAAAAATAGAGGGCACGG + Intergenic
947600049 2:231441566-231441588 AAAAAAAAGCACAGAAGGCCAGG - Intergenic
947621769 2:231595340-231595362 AAAAAATAGATTTTACGGCCGGG + Intergenic
947640284 2:231703802-231703824 AAGAAACAGAGAGGACGGCCAGG - Intergenic
947887176 2:233582932-233582954 AAAAAACAGAATAGAAAAACTGG - Intergenic
949083178 2:242121503-242121525 AAAAAAGAGAAAAGAAGGCTGGG - Intergenic
1169115530 20:3062985-3063007 AAAAAATAAAATAAAAGGCCGGG + Intergenic
1169245480 20:4021249-4021271 AAAGAAAAGAAAAGAGGGCCAGG - Intergenic
1169885294 20:10391999-10392021 AAAAAACAGATTATCAGGCCAGG + Intergenic
1169959316 20:11141376-11141398 AAAGAAAAGATTAGAAGGCCTGG - Intergenic
1170322107 20:15111463-15111485 AGAAAACACACTAGAGGGCCAGG - Intronic
1170532166 20:17304888-17304910 ATAAAACACAATAGGAGGCCAGG - Intronic
1171050014 20:21849125-21849147 AAAAACCAGAAAAGTGGGCCAGG - Intergenic
1172295323 20:33806158-33806180 AAAACAAAGAATAGCCGGCGCGG - Intergenic
1172486223 20:35299279-35299301 AAAAAACACAACACATGGCCGGG + Intergenic
1172559718 20:35876273-35876295 AAAAGCCAGAAGAGATGGCCGGG + Intronic
1172586284 20:36087481-36087503 AAAAAAAAGAATAGACTGGGAGG - Intergenic
1173051399 20:39565600-39565622 AAAAATCATAAAAGACTGCCTGG - Intergenic
1173064319 20:39695449-39695471 AGAAAACACAATAGGAGGCCAGG - Intergenic
1173495876 20:43517090-43517112 AAAAAAAAAAAAAGACGACCAGG - Intronic
1173685558 20:44921107-44921129 AAGAAACAAAATTGATGGCCAGG - Intronic
1173780519 20:45753111-45753133 AAAAAATACAAAAGATGGCCAGG + Intronic
1174350377 20:49963309-49963331 AAAAAAAAAAATTCACGGCCGGG - Intergenic
1174381226 20:50156548-50156570 AAAAAAAAAAAAAGTCGGCCGGG - Intergenic
1174384806 20:50180933-50180955 AAAAAACAGAATTACTGGCCGGG + Intergenic
1174466443 20:50721254-50721276 AAAAAAAAGAAGAGCAGGCCGGG - Intergenic
1174627240 20:51925992-51926014 AACAAACAGGATACAAGGCCAGG + Intergenic
1174781303 20:53391438-53391460 AACAAACAAAAAAAACGGCCTGG - Intronic
1174807687 20:53618705-53618727 TTGAAACAGAATAGAGGGCCAGG - Intergenic
1174954667 20:55084203-55084225 AAAAAAAAAAAGAGAGGGCCGGG - Intergenic
1175087941 20:56476792-56476814 AGAAAACAGAAAACAAGGCCGGG - Intronic
1175132721 20:56801624-56801646 AAAAAAAAAAATATCCGGCCGGG - Intergenic
1175214458 20:57384300-57384322 AAAAGACACAAGAGAAGGCCAGG - Intergenic
1176192510 20:63818877-63818899 AAAAAAAAAAAAAGAAGGCCAGG + Intronic
1176279772 20:64294111-64294133 AAAAAAGAGAAAAGAAGGCTGGG - Intergenic
1176419813 21:6505028-6505050 AAAAAAAAAAAAAGAAGGCCAGG - Intergenic
1176638008 21:9266957-9266979 AAAAAACAGAGTAGAAAACCTGG + Intergenic
1177053764 21:16273516-16273538 AAATAACTGAATAAAGGGCCGGG + Intergenic
1177556002 21:22689456-22689478 AAAAAACAGAATTGAGGGTGAGG - Intergenic
1177729108 21:25005296-25005318 AAAAAACAGAAAAGAAGGGATGG + Intergenic
1177753171 21:25311479-25311501 ATAAAACAGAATGGAGAGCCTGG + Intergenic
1177812376 21:25938067-25938089 AATAAACAGTATAAAAGGCCAGG - Intronic
1178364387 21:31976760-31976782 AAAAAAAAAAAAAGAGGGCCAGG - Intronic
1178368691 21:32009220-32009242 AAACAAAAAAATAGAGGGCCTGG + Intronic
1178839838 21:36129984-36130006 AAAAATAAAAATAGGCGGCCGGG + Intergenic
1178962947 21:37084697-37084719 TAAAAACAAAATACAAGGCCGGG + Intronic
1179020405 21:37635511-37635533 AAAAAACAAAATAATAGGCCAGG - Intronic
1179218114 21:39384553-39384575 AAAAAAAAAAATTGTCGGCCAGG - Intronic
1179695306 21:43113351-43113373 AAAAAAAAAAAAAGAAGGCCAGG - Intergenic
1179772803 21:43635942-43635964 AAAAAACAGAATCATAGGCCAGG + Intronic
1180422047 22:12874454-12874476 AAAAAACAGAGTAGAAAACCTGG + Intergenic
1180627364 22:17203067-17203089 GAAAAATGAAATAGACGGCCGGG - Intronic
1180632344 22:17238344-17238366 AAAAAAAAAAAAAGGCGGCCGGG + Intergenic
1181272706 22:21669004-21669026 AAAAAAAAAAATAGAGGGCCAGG - Intronic
1181300603 22:21878221-21878243 AAAAAAAAAAAAAGTCGGCCGGG + Intergenic
1181385741 22:22544346-22544368 ACAAAACAGAAAACAAGGCCGGG - Intergenic
1182137089 22:27916514-27916536 AAAAAAATAAATAGAGGGCCAGG + Intronic
1182138645 22:27932246-27932268 AAAAAACAAACAAAACGGCCAGG - Intergenic
1182631941 22:31692933-31692955 AAAAAAAAGAAAAGATGACCAGG - Intronic
1182639987 22:31759348-31759370 AAAAAACAAAAAAAACGGCTCGG - Intronic
1183219820 22:36505471-36505493 CAAAAATAGAATTGAAGGCCGGG + Intronic
1183644990 22:39120178-39120200 AAAAAAAAGAAGAAAGGGCCGGG - Intronic
1183775487 22:39961501-39961523 AAACCACAGAACAGAGGGCCAGG + Intronic
1183778184 22:39981568-39981590 AAAAAAAAAAATTGAGGGCCGGG - Intergenic
1184228828 22:43146928-43146950 AAAAAAAAAAAAAGACGGCCGGG + Intergenic
1184487669 22:44790725-44790747 AAAAAAAAAAAAAAACGGCCAGG - Intronic
1184612129 22:45611239-45611261 AAAAAACAGAAAACCAGGCCCGG + Intergenic
1184707331 22:46223646-46223668 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
1184895387 22:47403618-47403640 AAAAAAAAAAATAGAGGGGCAGG - Intergenic
1185307535 22:50128836-50128858 AAAAAAAAAAAAAGATGGCCGGG - Intronic
949478120 3:4467902-4467924 AAAAAACAACATAGCAGGCCGGG + Intergenic
949874033 3:8612417-8612439 AAAAAACAGAACAGAAGAACTGG + Intergenic
949888888 3:8716989-8717011 AAAAAACAGAACAGAAGAACTGG + Intronic
949959314 3:9299065-9299087 AAAAAAGAAAATAGATGGCTGGG + Intronic
949992088 3:9587981-9588003 AAAAAAAAGAATTGAAGGCTGGG - Intergenic
949995788 3:9615679-9615701 AAAAAAGAGAAAGGAAGGCCAGG + Intergenic
950071778 3:10158443-10158465 AAAAAAAAGAAAAGGAGGCCGGG - Intergenic
950317214 3:12013593-12013615 AAAATACAGAATAGAAGAGCTGG - Intronic
950366950 3:12493431-12493453 TAAAAAAATAATAGTCGGCCAGG + Intronic
950412494 3:12848296-12848318 ATAAAACACAATAGATGGGCTGG + Intronic
950704728 3:14772766-14772788 AAAGATCAAAATAGAGGGCCGGG - Intronic
950815765 3:15700478-15700500 AAAAAACACTATATAGGGCCGGG + Intronic
950829972 3:15863719-15863741 AAAAAAAAGTCTATACGGCCAGG + Intergenic
951783352 3:26389833-26389855 AAAAAACAGAATAGAAAAACTGG - Intergenic
952480914 3:33760963-33760985 AAAAAATAAAATAGTTGGCCAGG - Intergenic
952518851 3:34133867-34133889 AAAAATCAGAATAGACAGAAAGG + Intergenic
952653449 3:35754678-35754700 CAAAAACGGTATAGATGGCCAGG + Intronic
952790397 3:37195974-37195996 AAAAAAAAAAAAAGACAGCCTGG + Intergenic
953591236 3:44256893-44256915 TAAAAGCAGAAAAGAAGGCCAGG - Intronic
953747286 3:45584979-45585001 AAAACAGAGAAGAGAGGGCCAGG - Intronic
953830775 3:46295983-46296005 AAAAATCAGAACATATGGCCGGG + Intergenic
953858890 3:46525247-46525269 AAAAAAAAGAAAAAAAGGCCTGG - Intronic
954014709 3:47677394-47677416 AAAAAAAAAAAAAAACGGCCAGG - Intronic
954020331 3:47735048-47735070 AAAAAAAAAAATTGAAGGCCGGG - Intronic
954020871 3:47740169-47740191 AAAAAAAAAAAAAGATGGCCGGG - Intronic
954208939 3:49082902-49082924 AAAAAAAAGAAAAAAAGGCCAGG + Intronic
954342067 3:49962156-49962178 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
954351284 3:50046282-50046304 AAAAAAAAAAAAAGACGGCCAGG + Intronic
954612423 3:51952833-51952855 AAAAAAAAAAAAAGAAGGCCGGG + Intergenic
954814755 3:53271747-53271769 AAAAAAAAAAAGAGTCGGCCAGG - Intergenic
955292368 3:57704387-57704409 AAAAAAAAAAATAGACTGCTCGG + Intergenic
956102963 3:65787660-65787682 ATAAAACAGAGTAGACTGTCAGG + Intronic
956125734 3:66009218-66009240 AAAATAAAGAATATCCGGCCAGG + Intronic
956203103 3:66728078-66728100 AAAAAGCAGAAGAGAGTGCCAGG - Intergenic
956311089 3:67881345-67881367 AGAAAACAGAAAACTCGGCCGGG - Intergenic
956426058 3:69136615-69136637 AAAAAACAGAAAAATTGGCCTGG + Intergenic
956532346 3:70234486-70234508 AAAAAATAGAATAATCAGCCAGG + Intergenic
956961446 3:74407248-74407270 AAAAAATAGAATATTTGGCCTGG - Intronic
956989601 3:74747897-74747919 AAAAAACAAATCAGAAGGCCGGG - Intergenic
957226530 3:77455723-77455745 AAAAAAAAGAGTATAAGGCCGGG - Intronic
957371993 3:79306491-79306513 AAAAAACGGAAAAGATTGCCAGG - Intronic
958202225 3:90334984-90335006 AAAAAACAGAACAGAAAACCTGG + Intergenic
958501475 3:94914993-94915015 AAAAAAAAGAATAGACTGTGTGG + Intergenic
958795273 3:98700509-98700531 AAAAAAAAGGAAAGAAGGCCAGG - Intergenic
958952817 3:100434822-100434844 AAAAAAAAAAAAAGACAGCCGGG - Intronic
959198949 3:103221357-103221379 AAAAAACAGAATAGAAAAACTGG + Intergenic
959713800 3:109411071-109411093 AAAAAAAAAAATAGCCGGCATGG - Intergenic
960399384 3:117177576-117177598 AAAAAAAAAAATAGCAGGCCGGG - Intergenic
960668196 3:120131451-120131473 AAAAAACACCATGGTCGGCCAGG + Intergenic
961700590 3:128741677-128741699 AAAAAACAAAAGACACAGCCAGG - Intronic
961732298 3:128974824-128974846 AAAAAAAAGAAGAGAAGGCCAGG + Intronic
961840396 3:129705885-129705907 AAAAAAAAGAAAAAAAGGCCGGG - Intronic
962225189 3:133600223-133600245 AAAAAAAAGAATTGCAGGCCAGG - Intronic
962248076 3:133814424-133814446 AAAAAACAAAAAAACCGGCCAGG - Intronic
962786457 3:138772767-138772789 AAAAAAGAGAATAAATAGCCGGG - Intronic
962787211 3:138779379-138779401 AAAAAAAAAAAAAGAAGGCCGGG - Intronic
962796643 3:138855349-138855371 ATAAAACAGAAATGTCGGCCAGG - Intergenic
963295794 3:143544997-143545019 ATAAAACAGAATAGAGAACCCGG - Intronic
963725001 3:148909946-148909968 AAAAAACAGTCTATACAGCCGGG + Intergenic
963780162 3:149479060-149479082 AAAAAACAGAACAATCGGCCAGG - Intronic
963881736 3:150536236-150536258 AACAAACAAAAAAGAGGGCCAGG + Intergenic
964348741 3:155781780-155781802 AAAAAAAAAAATAGTGGGCCGGG + Intronic
964488436 3:157209398-157209420 AAAAAAAAGAGTCAACGGCCAGG - Intergenic
965193493 3:165562425-165562447 AAAAAACAGAATCGACCAACAGG + Intergenic
966387985 3:179422329-179422351 ATAAAACAGAATATAAGGCCAGG + Intronic
966856610 3:184198359-184198381 AAAAAAAAAAAAAGTCGGCCGGG - Intronic
967046494 3:185742196-185742218 AAAAAAAAAATTAGCCGGCCAGG + Intronic
967148918 3:186630353-186630375 AAAAAAATAAATAGAAGGCCAGG - Intergenic
967255079 3:187582977-187582999 ATGGAACAGAATAGACAGCCCGG - Intergenic
967925120 3:194639890-194639912 AAAAATCAGCATATCCGGCCAGG - Intergenic
967984184 3:195083081-195083103 ACAAAACAGGATAGAGCGCCCGG + Intronic
968029095 3:195467512-195467534 AATAATCAGAACAGCCGGCCAGG + Intergenic
968173111 3:196526274-196526296 AAAAATCAAAATATGCGGCCAGG + Intergenic
1202748887 3_GL000221v1_random:138064-138086 AAAAAACAGAGTAGAAAACCTGG - Intergenic
968822334 4:2864115-2864137 AAATAACAGAATTTATGGCCGGG + Intronic
969047897 4:4350887-4350909 AAAAAAAAGAGTACAGGGCCAGG + Intronic
969114648 4:4863597-4863619 AAAAAAAAGACTAGCCAGCCAGG + Exonic
969382944 4:6818411-6818433 AAAAAAAAGAATACACTCCCTGG + Intronic
969695764 4:8733432-8733454 AAGAAAAAGAATACAAGGCCGGG + Intergenic
969819932 4:9712228-9712250 GAAAAACAAAATTGAGGGCCGGG - Intergenic
970552630 4:17198421-17198443 ACAAATAAGAATAGTCGGCCAGG + Intergenic
970565233 4:17325553-17325575 ACAAAACAGAATATACAGCCCGG - Intergenic
970597324 4:17612384-17612406 AAGAACCAGAAGAGACCGCCAGG - Intergenic
971093815 4:23375230-23375252 AGAAAACAGAATCTAAGGCCAGG + Intergenic
971392140 4:26195887-26195909 AAAATACAAAACACACGGCCAGG - Intronic
971850076 4:31974266-31974288 AAACAACACAATAGACATCCAGG - Intergenic
971984876 4:33808419-33808441 AGAAAACAGAACAGATGGCCAGG - Intergenic
972155919 4:36161811-36161833 AAAAAAAAAACTACACGGCCTGG + Intronic
972193082 4:36618279-36618301 AAAAAAAAAATTAGAAGGCCAGG + Intergenic
972470932 4:39403872-39403894 AAAAAAAAAAAAAGACGGCCGGG + Intergenic
972483375 4:39519210-39519232 AAAAAAAAAAAAATACGGCCAGG - Intronic
972979834 4:44683401-44683423 AAAAAACAGCATATAATGCCAGG - Intronic
973282749 4:48376904-48376926 AAAAAAAAAAAAAGTCGGCCGGG - Intronic
973597198 4:52504439-52504461 AAAAAACAGAACAGAAAACCTGG - Intergenic
973924986 4:55728298-55728320 AAAAAAAAAAATACACGGCCAGG - Intergenic
973986493 4:56359553-56359575 AAAAAAAAGAACATAAGGCCGGG - Intronic
974515467 4:62902517-62902539 AAAAAAAAGAATGGAGGGTCTGG + Intergenic
975108340 4:70595176-70595198 AAAAAAAAGAATAGAGGGAAAGG - Intronic
975119866 4:70716546-70716568 AAAATACAGCATTGAAGGCCAGG + Intronic
975139930 4:70908321-70908343 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
975555335 4:75658433-75658455 AAAAAAAAAAAAAGCCGGCCGGG + Intronic
975641450 4:76504452-76504474 AAAAAACTGATAAGTCGGCCGGG - Intronic
975930263 4:79512942-79512964 AAAATACAGAAAAGTTGGCCGGG - Intergenic
976371979 4:84299691-84299713 AAAAAACAGAACAGAAAACCAGG + Intergenic
976420615 4:84839560-84839582 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
976754550 4:88483823-88483845 CAAAAACCTAATAGAAGGCCAGG - Intronic
977602101 4:98944539-98944561 AAAAAAAAAAAAAGAAGGCCGGG - Intergenic
978448466 4:108803454-108803476 TTAAAACAGACTAGACGGCCGGG + Intergenic
978552744 4:109945439-109945461 AAAAAAACAAATAGAAGGCCAGG + Intronic
979197223 4:117934230-117934252 AAAAAAGAGAATAATCGGCTGGG + Intergenic
979260636 4:118639898-118639920 AAAAAAGAGAAAAGAAGGCTGGG - Intergenic
979287245 4:118940280-118940302 AAAAGAGAGAAAAGGCGGCCAGG - Intronic
979444471 4:120794919-120794941 AAAAAATAGAATAGAAGGCTGGG - Intronic
979933023 4:126655931-126655953 AAAAAAAAGAACAGGAGGCCAGG - Intergenic
980538692 4:134164282-134164304 AAAAAAAAAAATAGAAGTCCTGG + Intergenic
980937325 4:139238427-139238449 TAAAAAAAGAATTGGCGGCCGGG + Intergenic
981181289 4:141748723-141748745 ATAGAACAGAATAGAGAGCCCGG + Intergenic
981408441 4:144399189-144399211 AAAAAACATAATACCCAGCCGGG + Intergenic
981680202 4:147388854-147388876 AAAAAACAGAAAAGCCAGTCAGG + Intergenic
981755253 4:148135759-148135781 AAAAAACAACAAAAACGGCCGGG + Intronic
982072108 4:151704746-151704768 CAAAAACAAAAAAGAAGGCCAGG - Intronic
982111195 4:152056290-152056312 CAAAAACACAAAAGATGGCCAGG - Intergenic
982122478 4:152156382-152156404 AAAAGACAGCACAGAGGGCCGGG - Intergenic
982128060 4:152201454-152201476 AAAGAATAGAATAGAGGACCAGG + Intergenic
982167892 4:152631725-152631747 AAAAAACACAATAGGCTGGCTGG - Intronic
982330489 4:154177064-154177086 AAAAGAAAGAAAAGACAGCCGGG - Intergenic
982511576 4:156289681-156289703 AAAAAACAGAACAGAAGAACTGG - Intergenic
983026780 4:162747389-162747411 TAAAAACTCAATAGTCGGCCGGG - Intergenic
983232549 4:165143729-165143751 AAAAAACAGTATTGGTGGCCGGG - Intronic
983318925 4:166169712-166169734 AAAAAACAAAATAGTGGACCAGG - Intergenic
983531112 4:168810645-168810667 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
983937386 4:173511405-173511427 AAAAAACGGTATAGAGGGCCAGG - Intergenic
984154170 4:176173808-176173830 TAAAAACATAACAAACGGCCAGG - Intronic
984570477 4:181386914-181386936 AAAAAAAAAAATACACAGCCAGG + Intergenic
984634478 4:182095966-182095988 AAAAAACAGAATAAATATCCAGG + Intergenic
984740421 4:183156319-183156341 AAAAAAAAGAACAAAGGGCCAGG - Intronic
984780245 4:183519108-183519130 AAAAAAAAAAATACAAGGCCAGG - Intergenic
984893740 4:184516804-184516826 AAAAAACATAACAAACGGGCCGG - Intergenic
984919292 4:184749810-184749832 AAAAAACAGAAGTACCGGCCAGG + Intergenic
1202752905 4_GL000008v2_random:25374-25396 AAAAAACAGAGTAGAAAACCTGG + Intergenic
987035370 5:14013649-14013671 AAAAAAAAAAATAAAAGGCCAGG - Intergenic
987481356 5:18462669-18462691 ATATGACAGAATAGAGGGCCTGG + Intergenic
988659392 5:33248043-33248065 AAAAAACACAAAAGATGGCTGGG - Intergenic
988665472 5:33322558-33322580 CAAAAACAAAATAGACTTCCTGG + Intergenic
988862231 5:35294467-35294489 TAAAAATAGAATACACGGGCTGG + Intergenic
988887383 5:35573314-35573336 AAAAAACAGAATAGAAAAACTGG - Intergenic
989047254 5:37285042-37285064 AAAAACAACAAAAGACGGCCAGG + Intergenic
989137974 5:38174594-38174616 AAAAAACAGAATAGAAAAACTGG - Intergenic
989384927 5:40845633-40845655 AAAAAACAGAATAGATAAACAGG - Intronic
989781270 5:45267472-45267494 AAAAAACAGTTGAGAAGGCCAGG + Intronic
990093758 5:52087286-52087308 AAAAAACAGAAGAGAAGAACTGG - Intergenic
990159631 5:52923373-52923395 AAAAACAACTATAGACGGCCTGG - Intronic
990406897 5:55500718-55500740 TGAAGACAGAATAGACGGCAAGG + Intronic
990751720 5:59023498-59023520 AAAAAACAGAAAAGCCGGTCTGG + Intronic
991072127 5:62495629-62495651 AAAAAACAGAAAAATCAGCCAGG - Intronic
991539440 5:67710157-67710179 AGAAAACAGACTAGAGAGCCTGG + Intergenic
991692314 5:69236945-69236967 AAAAAAAAAAAAAGAAGGCCAGG - Intronic
991772180 5:70050560-70050582 TTAAAACAAAATAAACGGCCGGG + Intronic
991851473 5:70925978-70926000 TTAAAACAAAATAAACGGCCGGG + Intronic
992257668 5:74937501-74937523 AAAAAACAGACTTTAGGGCCAGG - Intergenic
992343733 5:75853562-75853584 AAAAAAAAAAAAAGACAGCCTGG + Intergenic
992379190 5:76220374-76220396 AAAAATTAGAATTGACAGCCGGG + Intronic
992424798 5:76645836-76645858 AAAAAACAGAATGGACGAATGGG + Intronic
993186429 5:84627773-84627795 AAAAAGGAGAGTAGAGGGCCTGG + Intergenic
993518211 5:88864123-88864145 AAAAAACAGAAAACATGGCTGGG - Intronic
993590442 5:89789188-89789210 AACACACAGAAGAGAGGGCCAGG + Intergenic
993693851 5:91036563-91036585 AAAAAAAAAAAAAAACGGCCAGG + Intronic
993716248 5:91278433-91278455 AAAAAAAAAAAGAGCCGGCCAGG + Intergenic
993815770 5:92543052-92543074 ATAAAACCGAACAGGCGGCCGGG - Intergenic
994377831 5:99035068-99035090 AAAAATCAGTAGAGACTGCCAGG - Intergenic
994622254 5:102177351-102177373 AAAAAACCGAAAAGCTGGCCGGG - Intergenic
994850845 5:105053300-105053322 AAAGATCAAAAGAGACGGCCGGG - Intergenic
995092518 5:108194791-108194813 AAAAAAGAAGATTGACGGCCAGG + Intronic
995233580 5:109799457-109799479 AAAAAACAAAAAAGCAGGCCAGG + Intronic
995448092 5:112268688-112268710 AAAAAACAAATTAGCCAGCCAGG + Intronic
995554277 5:113311675-113311697 AAAAAAAATAATAGCTGGCCGGG + Intronic
995858016 5:116614274-116614296 AAGAAATACAATATACGGCCAGG + Intergenic
996078536 5:119227596-119227618 AAAAAACAGAAAAACTGGCCTGG - Intronic
996130875 5:119779856-119779878 AAAAAACAGAACAGAAGAACTGG - Intergenic
996245333 5:121256492-121256514 AAATAACACAAAAGACGGGCAGG - Intergenic
996329876 5:122316641-122316663 AAAATAAAGAAAAGACGGTCTGG + Intronic
996431630 5:123385898-123385920 AAAAAATATAATAGTAGGCCTGG - Intronic
997324575 5:133009320-133009342 AAAAACCAAAAAAGATGGCCAGG + Intronic
997928508 5:138052938-138052960 AAAAAACAGAATTTCTGGCCAGG + Intergenic
997936185 5:138113252-138113274 AACAAACAAAAAAGATGGCCGGG - Intergenic
998068055 5:139174641-139174663 AAAAAACAAAAAAGACTGCAGGG + Intronic
998238949 5:140425551-140425573 AAAAAACAGAAAAGAGGCCTGGG - Intronic
998255904 5:140587861-140587883 AAAGAAAAGAAAAGATGGCCAGG + Intronic
998361801 5:141594743-141594765 AAAAAAAGGAAAAGGCGGCCAGG + Intronic
999667915 5:153933147-153933169 ATAAAAAATAAGAGACGGCCGGG + Intergenic
999779253 5:154835874-154835896 AAAAAAAAAAAAAGTCGGCCGGG - Intronic
1000053941 5:157587060-157587082 AAAAAATAAAATAAACTGCCAGG + Intergenic
1000619422 5:163465966-163465988 AAAAAAAAAAAAAGACAGCCGGG + Intronic
1000766238 5:165294070-165294092 AAAAAACTGAATAGATGGCCAGG + Intergenic
1000940423 5:167353800-167353822 ATAAAACACCATATACGGCCGGG - Intronic
1001616089 5:173044840-173044862 AAAAATCAAAATGGAGGGCCGGG - Intergenic
1002032867 5:176443657-176443679 AAAAAAAAGAAAAGAAGGCCAGG + Intergenic
1002273474 5:178088154-178088176 AAAAAAAAAAAAAGAAGGCCGGG - Intergenic
1002506374 5:179681952-179681974 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
1002506988 5:179686391-179686413 AAAAAAAAAAAAAGATGGCCGGG - Intronic
1002606781 5:180388183-180388205 AAATAAAAAAATAGATGGCCAGG + Intergenic
1002652227 5:180707369-180707391 AAAAAACAAAATATGGGGCCGGG + Intergenic
1002753346 6:141138-141160 AAAAAAGAGAAAAGAAGGCTGGG + Intergenic
1002942958 6:1733853-1733875 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
1002963060 6:1935580-1935602 AAAAATCAAAATAAACAGCCAGG + Intronic
1003132266 6:3404963-3404985 AAAAAAAAGATTTGTCGGCCAGG + Intronic
1003230340 6:4246178-4246200 AAAAAAAAAAATAGGCAGCCTGG - Intergenic
1003239716 6:4333826-4333848 AAAAAACAGAATAGAAAAACTGG - Intergenic
1003735559 6:8874165-8874187 AAAGAATAGAATATAGGGCCGGG - Intergenic
1003765796 6:9235004-9235026 AACAAACAGAATAGACAGCTTGG + Intergenic
1003918060 6:10806163-10806185 AAAAAAAAGAAAAGATGGCGGGG - Intronic
1004047832 6:12043660-12043682 AAAAAACAAATTACACGGCTGGG - Intronic
1004197535 6:13518484-13518506 TAAAAAAAGAAAAGTCGGCCCGG + Intergenic
1004227279 6:13797726-13797748 AAAAAACACACTTGCCGGCCAGG + Intronic
1004469285 6:15914483-15914505 AAAAAAAAGAATTGAAGGCAGGG + Intergenic
1004621720 6:17336326-17336348 AAAAATCAGAACAGGCTGCCAGG - Intergenic
1004712984 6:18190295-18190317 TAAAAACAGATAAGAAGGCCGGG + Intronic
1004984752 6:21068560-21068582 AAGGAACAGAATAGATGCCCAGG - Intronic
1005022307 6:21429994-21430016 AAAAAAAAAAAAAGAGGGCCAGG - Intergenic
1005045780 6:21640953-21640975 AAAAAAAGGAAAAGATGGCCGGG - Intergenic
1005301258 6:24473069-24473091 AAAAAAAAAAAAAGGCGGCCTGG - Intronic
1005390427 6:25327256-25327278 AAAGAACAGAAAGAACGGCCAGG + Intronic
1005744496 6:28823588-28823610 AAAGAAAAGACGAGACGGCCGGG + Intergenic
1005950863 6:30630333-30630355 CAAAAACAGAAAAAAAGGCCAGG + Intronic
1006179689 6:32147438-32147460 GAAAAACAGAATTCACGGCTGGG - Intergenic
1006185978 6:32182026-32182048 AAAAAAAGGAACAGACGGCTGGG - Intronic
1006324075 6:33340019-33340041 AAAGAAAAGAAAAGAAGGCCAGG + Intergenic
1006487018 6:34351444-34351466 AAAAAAAAAATTAGAGGGCCAGG + Intronic
1006504260 6:34477907-34477929 AAAAAAAAAAAAAGATGGCCAGG - Intronic
1006533390 6:34677009-34677031 AAAAAAAAGAATTGAAGGCTGGG + Intronic
1006605630 6:35254872-35254894 CAAAAACAAAAAAAACGGCCAGG + Intergenic
1006667978 6:35711321-35711343 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
1006727770 6:36212168-36212190 AAAAAGAAGAAAAGACAGCCAGG + Intronic
1006821518 6:36900180-36900202 AAAAAACAAAACACAAGGCCAGG - Intronic
1006970811 6:38043274-38043296 AATAAACAGAATAGAGGGCTGGG - Intronic
1007004146 6:38344206-38344228 AAAAAGCAGAATAAACAGTCTGG + Intronic
1007303353 6:40885352-40885374 AACAAAGAGAATAGAAGGGCAGG - Intergenic
1007546929 6:42701416-42701438 AAAACACAAAAATGACGGCCAGG - Intronic
1007642127 6:43349952-43349974 AAAAAAAAGAAAAAAAGGCCGGG + Intronic
1007659238 6:43472582-43472604 AGAAAATAGAATGGTCGGCCGGG - Intergenic
1008112779 6:47511094-47511116 AAAAAAAGGAATAGATGGACAGG + Intronic
1008758244 6:54823667-54823689 AGAAAAAAGAATAAAAGGCCAGG - Intergenic
1008860504 6:56143493-56143515 AAAAAATTGTATAGTCGGCCGGG - Intronic
1009489737 6:64274474-64274496 AAAAAAAAAAAAAAACGGCCAGG - Intronic
1009551310 6:65096660-65096682 ATCAAACAGAATAGACAGCCTGG + Intronic
1009870222 6:69444633-69444655 AAAAAACAGAATAGAAAAGCTGG - Intergenic
1010201918 6:73289664-73289686 AAAAAAGAAAAAAAACGGCCAGG + Intronic
1010233349 6:73554667-73554689 AAAAAACATAATTTATGGCCGGG - Intergenic
1010347427 6:74827687-74827709 AAAAAACTGTATAGCTGGCCGGG - Intergenic
1010380536 6:75219016-75219038 AAAAAAAAAAATAGATGGCATGG + Intergenic
1010437016 6:75843462-75843484 TAGAAAAAGAATAGATGGCCGGG + Intronic
1010530303 6:76959886-76959908 AAAAAACAGAATAGAAAAACTGG + Intergenic
1010763018 6:79746299-79746321 AAAAAAGAAAAAAGAAGGCCGGG - Intergenic
1011293077 6:85797481-85797503 AAAAAATAGAATAGAGAGGCAGG + Intergenic
1011307761 6:85947696-85947718 AAAAAAAAAAAAAGAAGGCCGGG + Intergenic
1011444956 6:87428281-87428303 AAAAAAAAAAAAATACGGCCAGG - Intronic
1012475424 6:99611413-99611435 AAAAGAGAGAATAGACCTCCTGG - Intronic
1012905516 6:105060196-105060218 AAAAAACAGAGTAAAAGGCTGGG - Intronic
1012936385 6:105372214-105372236 AAAAAACAGAAAAGAAAGCAAGG + Intronic
1013031991 6:106342756-106342778 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
1013147672 6:107410788-107410810 AAAAAACAGGGTAGATGCCCAGG - Intronic
1013246665 6:108293927-108293949 AAAAAAAAAAAGAGAAGGCCCGG - Intergenic
1013257805 6:108406731-108406753 AAAAAAGAGAAGATAAGGCCAGG - Intronic
1013513912 6:110868442-110868464 AAAAATAAGAAAAGACGTCCGGG - Intronic
1013775588 6:113675445-113675467 AAAAAAAAAAAAAAACGGCCGGG + Intergenic
1013866062 6:114697599-114697621 AAAAAACAATAAAAACGGCCGGG - Intergenic
1014293454 6:119588471-119588493 AAAAAACAAAAAAAATGGCCAGG - Intergenic
1014437110 6:121432824-121432846 AGAAAACAGAATCAAAGGCCTGG + Intergenic
1014595998 6:123339298-123339320 AAAAAACCTAATACATGGCCGGG - Intronic
1014628049 6:123753308-123753330 AAAAAAAAAAAAAGAAGGCCAGG - Intergenic
1015030117 6:128584916-128584938 AAAAAACATAATTAAGGGCCGGG - Intergenic
1015357617 6:132297476-132297498 AGGAAACAGAAAAGAGGGCCAGG + Intronic
1015727264 6:136312077-136312099 AATGAACAGAATAAACAGCCTGG + Intergenic
1015770073 6:136759750-136759772 AAAAAAAAAAATAGAGGGCTGGG - Intronic
1016087951 6:139937779-139937801 AAAAAGAACAACAGACGGCCGGG - Intergenic
1016460436 6:144275571-144275593 AAAAAAAAGGTTAGAAGGCCAGG + Intergenic
1016499762 6:144706478-144706500 AAAAAATAAAATAAACTGCCAGG - Intronic
1016536182 6:145109277-145109299 TAAAAACAGAATTAATGGCCAGG - Intergenic
1016937160 6:149455956-149455978 AAAAAAAAAAAAAGACAGCCAGG + Intronic
1017118657 6:151003234-151003256 TAAAAACAGAAAAGTTGGCCGGG + Intronic
1017168187 6:151429414-151429436 AAAGAGCAGATTATACGGCCAGG - Intronic
1017249075 6:152260580-152260602 TAAAAACAGAATAGAAAGCGTGG + Intronic
1017422137 6:154283299-154283321 AAAAAAAAAAAAAGAGGGCCGGG + Intronic
1017443559 6:154486787-154486809 TAAAAAAAGAAAAGATGGCCAGG - Intronic
1017610971 6:156185830-156185852 AATAAACAGTATACACAGCCTGG - Intergenic
1017630698 6:156393713-156393735 AAAAAAAAAAAAAGACAGCCTGG + Intergenic
1017877825 6:158538127-158538149 AAAAAACAGAGTAGGGGGCGGGG - Intronic
1017915396 6:158827728-158827750 AAAAAAAAGAAATAACGGCCGGG + Intergenic
1018095811 6:160386247-160386269 AGAAAACAGAAAAGACAGGCTGG - Intronic
1018523747 6:164683907-164683929 AAAAAAAAAAAAAAACGGCCAGG + Intergenic
1019356144 7:580256-580278 AAAAAACAGAAAAACTGGCCGGG + Intronic
1019394869 7:812423-812445 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
1019669999 7:2272363-2272385 AAAAAAAAGAAAAGAAGACCTGG - Intronic
1019678467 7:2330124-2330146 AAAAAAAAGAAAAAAGGGCCGGG - Intronic
1019706907 7:2501204-2501226 AAAAAAAAAAAAAGAGGGCCGGG + Intergenic
1019922244 7:4170453-4170475 AAAGAACAGAACAGACTACCTGG + Intronic
1020059060 7:5138881-5138903 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
1020160082 7:5763891-5763913 AAAAAATAAAACAGACGGCAGGG + Intronic
1020230581 7:6315259-6315281 AAAAAAAGAAATAGTCGGCCAGG - Intergenic
1020318234 7:6922075-6922097 GAAAAACAAAATTGAGGGCCAGG + Intergenic
1021585908 7:22208007-22208029 AACACACAGAAGAGAGGGCCAGG - Intronic
1021616387 7:22506910-22506932 AAGGAACAGAATAGACCACCAGG - Intronic
1022068078 7:26882049-26882071 AAAAAAAAAAAAAAACGGCCAGG - Intronic
1022398062 7:30008679-30008701 AAAAAAAAAAAAAGCCGGCCAGG + Intergenic
1022683060 7:32568159-32568181 AAAAAAAAGAATAAGCGGGCTGG - Intronic
1022730275 7:33016374-33016396 AAAAAAAAAAAAAGAAGGCCGGG + Intronic
1022932712 7:35137597-35137619 AAAAAATAAAACAGACAGCCAGG + Intergenic
1023379519 7:39593009-39593031 AAAAAACAGAGAAGAAAGCCTGG - Intronic
1023466989 7:40466905-40466927 AAAAACCAGAACAGACGGGCCGG + Intronic
1023481495 7:40639663-40639685 AAAAAAAAAATTAGACGGCATGG - Intronic
1023490738 7:40737927-40737949 AAAAAACAAAAAAAAAGGCCGGG + Intronic
1023803981 7:43858395-43858417 AAAAAAAAGAAAAAAAGGCCAGG - Intergenic
1024325540 7:48106605-48106627 AAAAAACAAAGTAGAGGGCTGGG - Intronic
1024998685 7:55295690-55295712 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
1025059876 7:55796827-55796849 AAAAAAGAGAAAAGAAGGCTGGG + Intronic
1025247232 7:57326575-57326597 GAAAAAAAGAAAAGAAGGCCTGG - Intergenic
1025619257 7:63153925-63153947 AAAAAACAGAACAGAAAACCTGG - Intergenic
1025732082 7:64116065-64116087 AAAAAACACAAAAGTTGGCCAGG - Intronic
1025773607 7:64537630-64537652 AAAAAACAGAATAGACGGCCAGG + Intronic
1025936956 7:66045089-66045111 AAAAAAAAAAATAGCCGGGCAGG - Intergenic
1025977826 7:66383244-66383266 GAAAAACAGAATAATAGGCCGGG - Intronic
1025992652 7:66507180-66507202 AAAAAACAGAAAAAGGGGCCAGG - Intergenic
1026006758 7:66606140-66606162 AAAAAAAAAAAAATACGGCCAGG - Intergenic
1026033313 7:66813851-66813873 AAAAAAAAGAAAAAAAGGCCGGG + Intergenic
1026246025 7:68620543-68620565 AAAAAATAGATTAGTAGGCCTGG + Intergenic
1026559889 7:71439934-71439956 AAAAAAAAAAAAAGAGGGCCTGG - Intronic
1026677421 7:72439568-72439590 AAAAAAAAGAATAAACGACAAGG - Intronic
1026856263 7:73757168-73757190 AAAAAAAAGAAGAGAGGGCCGGG + Intergenic
1026879147 7:73897724-73897746 AAAAAAGGGAGTGGACGGCCAGG - Intergenic
1026927069 7:74201813-74201835 AAAAAAAAGTAGAGCCGGCCGGG - Intronic
1026971563 7:74471696-74471718 AAAAAACAAAAAAAACGGCCGGG + Intronic
1027139116 7:75644625-75644647 AAAAAAAAGAATAAAAAGCCAGG + Intronic
1027228108 7:76257453-76257475 AAAAAAAAAAAAAGAAGGCCAGG + Intronic
1027249238 7:76388719-76388741 AAAAAAAAAAAAAAACGGCCGGG + Intergenic
1027264825 7:76488598-76488620 AAAAAAAAGAAAAGAGGGCTGGG + Intronic
1027316198 7:76986701-76986723 AAAAAAAAGAAAAGAGGGCTGGG + Intergenic
1027409322 7:77897975-77897997 AAAAAAAAAAACAGAAGGCCAGG - Intronic
1027611507 7:80367368-80367390 AAAAAAAAAAAAAGAAGGCCAGG + Intergenic
1027642771 7:80757673-80757695 ATAAAATAAAAAAGACGGCCGGG + Intronic
1028415709 7:90578326-90578348 AAAAAAATGAAAAGAAGGCCAGG + Intronic
1028553202 7:92094537-92094559 AAAAAAGAAAAAAGAGGGCCGGG + Intronic
1028596870 7:92555062-92555084 AAAAAAAAGAATCTACTGCCAGG - Intergenic
1028690757 7:93647021-93647043 AAAAATCAGAAAAGGGGGCCGGG + Intronic
1028748783 7:94358408-94358430 ATTAAACAGAATAGAGAGCCTGG + Intergenic
1029172816 7:98642890-98642912 AAAAAAAAAAATAGTTGGCCAGG + Intergenic
1029277302 7:99414404-99414426 TAAAAACAGAATAAGCCGCCGGG - Intronic
1029473761 7:100770641-100770663 AGAAAAAAGAAAAAACGGCCAGG - Intronic
1029572149 7:101377152-101377174 AGAAAAAAGAAAAGAAGGCCAGG - Intronic
1029626070 7:101720903-101720925 AAAAAAGAGAAGACAAGGCCTGG - Intergenic
1029828632 7:103230364-103230386 AAAAAATAAAAGAGACAGCCGGG + Intergenic
1029838564 7:103338613-103338635 AAAAAAAAGAAGAGACAGGCTGG + Intronic
1030026513 7:105329598-105329620 AAAAAAAAAAATAGAAGGCTAGG + Intronic
1030579533 7:111336200-111336222 AAAAAAAAAAATAGCCGGCCTGG - Intronic
1031602741 7:123732030-123732052 TAAAAACAGAAAAGGCGGCCAGG + Intronic
1031866746 7:127045435-127045457 AAATAACGGATTAGACTGCCTGG - Intronic
1032004902 7:128293047-128293069 AAAAAACAGAACAGAAGAACCGG + Intergenic
1032061456 7:128728647-128728669 AAAAATCAGAATATTTGGCCTGG - Intronic
1032085736 7:128882780-128882802 AAAAAACAGAAAAGTCGGCGAGG + Intronic
1032147451 7:129396714-129396736 AAAAAACCAAACACACGGCCAGG - Intronic
1033349765 7:140552691-140552713 ATAAAACACAAAAGAAGGCCAGG - Intronic
1033357915 7:140615692-140615714 AAAAAAAAAAATAGCCGGACAGG - Intronic
1034035602 7:147817607-147817629 AAAAAATAGCAAAGAAGGCCGGG + Intronic
1034190384 7:149209021-149209043 AAAAAAAAAAAAAGAGGGCCGGG + Intronic
1034554060 7:151838717-151838739 AAAAAAAAGTAAAGAAGGCCAGG + Intronic
1034571995 7:151963691-151963713 AAAAATTAGAATAAATGGCCAGG - Intronic
1034604698 7:152301207-152301229 AAAAAAAAGAAAAGTTGGCCGGG + Intronic
1034720942 7:153292136-153292158 AAGAAAAAGAATAGGAGGCCAGG + Intergenic
1035164400 7:156976618-156976640 AAAAAACAGAAAAAACAGGCCGG - Intergenic
1035248739 7:157582578-157582600 AGAAAACAGTATGGAGGGCCAGG + Intronic
1035418981 7:158711446-158711468 AAAAAAAAAAATTCACGGCCGGG + Intergenic
1035582635 8:749284-749306 AAATAAAAGAAAAGAAGGCCAGG - Intergenic
1035790683 8:2301558-2301580 ACAAAACAGAATAGAAGGAGGGG + Intergenic
1035802122 8:2420147-2420169 ACAAAACAGAATAGAAGGAGGGG - Intergenic
1035884865 8:3280911-3280933 AAAAAAAAGAAGTGATGGCCAGG + Intronic
1036395598 8:8367934-8367956 AAAAAACACTATATACGGCCAGG - Intronic
1036534452 8:9633022-9633044 AAAGAACAACATAGAGGGCCGGG - Intronic
1037272329 8:17143782-17143804 AAAAAACATAAAAGTTGGCCAGG - Intergenic
1038296807 8:26299760-26299782 AAGAAACACAGAAGACGGCCTGG - Intronic
1039061686 8:33576904-33576926 TAAAAACAAAAAATACGGCCGGG - Intergenic
1039068134 8:33627157-33627179 TAAAAACAAAATGGAAGGCCTGG - Intergenic
1039632172 8:39124000-39124022 AAAAAAAAAAAAAGAAGGCCAGG - Intronic
1039814479 8:41080881-41080903 AACAAAAAAAATAGAGGGCCGGG + Intergenic
1039940253 8:42084201-42084223 AAATAACAGAAAATACAGCCTGG - Intergenic
1040015957 8:42700308-42700330 AAAAAACAAAAAACAAGGCCGGG - Intronic
1040025796 8:42780894-42780916 AAAAAGAAGAAAAGATGGCCAGG - Intronic
1040055367 8:43052834-43052856 AAAAAAAGAAAAAGACGGCCAGG - Intronic
1040658222 8:49538193-49538215 AAAAAACAAAATGTCCGGCCGGG + Intronic
1040921689 8:52627486-52627508 AAAGAACAGAATAGATATCCTGG - Intronic
1041066430 8:54086566-54086588 AAAAAAAAAAAAAGACAGCCAGG + Intronic
1042168330 8:65968490-65968512 AAAAATCAGAATTAACAGCCTGG + Intergenic
1042244178 8:66694254-66694276 AAAAAAAAAAATAGTGGGCCAGG - Intronic
1042266629 8:66915165-66915187 AAAAAATAAAATAAATGGCCAGG + Intronic
1042276400 8:67009270-67009292 AAAAAATAAAATAAAGGGCCGGG + Intronic
1042323019 8:67498030-67498052 AACAAAGAGAATAGACAGCAAGG - Intronic
1042511451 8:69616695-69616717 AAAAAAAAAAAAAAACGGCCGGG - Intronic
1042921422 8:73923697-73923719 AAAAAAAAAAAAAGATGGCCTGG - Intergenic
1042927483 8:73980661-73980683 AAAAAACATATCGGACGGCCAGG - Intronic
1043918334 8:85951083-85951105 AAAAAAAAAAAAAGAGGGCCGGG + Intergenic
1044138822 8:88621748-88621770 AAAAAACTGTATAGACAGCCCGG - Intergenic
1044183091 8:89219224-89219246 AAAAAACAGAATAGAAAAACTGG + Intergenic
1044243263 8:89911637-89911659 AAAAAAAAGAAAAGAGGGCCAGG + Intronic
1044386879 8:91599479-91599501 AAGAAACAGAATAGAGGGGGTGG - Intergenic
1044844188 8:96364226-96364248 AAAAATAATAATAAACGGCCAGG + Intergenic
1045274284 8:100688432-100688454 AAAAAAAAAAAAAAACGGCCAGG + Intronic
1045878496 8:107010704-107010726 AAAAAATAGAAAAGACGACTTGG - Intergenic
1045945899 8:107795553-107795575 AAAAACCATAATAGATGGCAAGG + Intergenic
1046494425 8:114995350-114995372 ATGAAACAGAATAGAGAGCCTGG - Intergenic
1047090114 8:121565293-121565315 GAAAAACAGTATGGAGGGCCAGG + Intergenic
1047317860 8:123750919-123750941 AAAAAAAAGAAAAGGAGGCCAGG - Intergenic
1047319115 8:123762900-123762922 AAAAAATAAAATTGATGGCCGGG + Intergenic
1047593246 8:126349641-126349663 TAAAAAAAGAATAGTCGGCCAGG + Intergenic
1048065925 8:130968464-130968486 AAAAAGCAGAATAACTGGCCGGG - Intronic
1048518180 8:135129689-135129711 ACAAAACACAATAGACTGCATGG + Intergenic
1049626699 8:143626478-143626500 AAAAAAAAGAATATCGGGCCGGG - Intergenic
1050077337 9:1878542-1878564 AAAAAAAAAAAAAGAAGGCCTGG - Intergenic
1050531850 9:6597639-6597661 AAATAAGAGAATATATGGCCGGG + Intronic
1050547540 9:6721577-6721599 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
1050865091 9:10488375-10488397 AAAAAAAAAAAAAGACTGCCAGG + Intronic
1051308284 9:15740030-15740052 AAAAAACACATTGGAGGGCCAGG - Intronic
1052773613 9:32711289-32711311 AAAAAACAGAATAGAAAAACTGG + Intergenic
1053074170 9:35118687-35118709 AAAAAAAAAAAAAAACGGCCGGG - Intergenic
1053217403 9:36283646-36283668 AAAAAAAAAAAAAAACGGCCGGG - Intronic
1053235383 9:36449268-36449290 AAAAAATAAAATAAACAGCCAGG + Intronic
1053247389 9:36545783-36545805 ATAAAAAAGAATAGGCGGCCGGG + Intergenic
1053298424 9:36931551-36931573 AAAAAACAAAAAACATGGCCAGG + Intronic
1053326476 9:37157200-37157222 AAAAAAAAAAAAAGGCGGCCGGG + Intronic
1053345564 9:37375781-37375803 AAAAATCTCAATAGAAGGCCTGG + Intergenic
1053516643 9:38735893-38735915 AAAAAACAGGCAAAACGGCCGGG - Intergenic
1053651760 9:40176649-40176671 AAAAAAAAGAATAGACAGGACGG - Intergenic
1054532825 9:66199554-66199576 AAAAAAAAGAATAGACAGGACGG + Intergenic
1054779629 9:69154627-69154649 AAAAAAAAAAAAAGAAGGCCAGG + Intronic
1054876589 9:70103684-70103706 AAAAAGGTGAAAAGACGGCCAGG + Intronic
1055802564 9:80056250-80056272 ATGAAACAGAATAGAGAGCCCGG + Intergenic
1055851328 9:80633683-80633705 AAAAAACAAAACAAAAGGCCAGG - Intergenic
1055867048 9:80827492-80827514 ATAAAAAATAACAGACGGCCAGG + Intergenic
1056328832 9:85504887-85504909 AAAAAAAAAAAAAGAAGGCCAGG - Intergenic
1056463698 9:86833131-86833153 AGAAATCAGAAGAGAGGGCCTGG - Intergenic
1056559196 9:87715522-87715544 AAAAAAAAAAAAAGGCGGCCAGG - Intergenic
1056616686 9:88173905-88173927 CAAAAAATGAACAGACGGCCAGG + Intergenic
1056632887 9:88308134-88308156 AAAAAACAGCAAAGACTCCCTGG + Intergenic
1056721621 9:89076881-89076903 AAAAAACAGACAATAGGGCCGGG + Intronic
1056811625 9:89769474-89769496 AAAAAAAAGAATAGGAGGCCGGG - Intergenic
1056831510 9:89920826-89920848 ACAAAACAGCATAGACTGCATGG - Intergenic
1056879334 9:90375747-90375769 GAAAAAGAAAAAAGACGGCCGGG + Intergenic
1056981047 9:91312568-91312590 AAAATACAAAATAGCCGGCGTGG + Intronic
1057108213 9:92441596-92441618 AAAAAACACAAAAGTCAGCCTGG + Intronic
1057606760 9:96504049-96504071 AAAAATCATAAAAGACGGACGGG + Intronic
1058308828 9:103475394-103475416 AAAAAACTGAATTCAGGGCCGGG - Intergenic
1058352920 9:104047910-104047932 AAAGAACAGAATAGAAGGATTGG + Intergenic
1058437744 9:104978894-104978916 AAAAAATAAAATAGTTGGCCAGG + Intergenic
1058534625 9:105945695-105945717 ATAAAACAGAATAGAGAGCCAGG - Intergenic
1058715688 9:107720206-107720228 AAAAGTCAGAATAGCAGGCCGGG - Intergenic
1058874545 9:109232344-109232366 AAAAAACAGAATAAAGGCACAGG - Intronic
1059604391 9:115818142-115818164 AAAAAACAAGAAAGACGGCAGGG - Intergenic
1059622186 9:116018902-116018924 AAAAAACAAGAAAGAGGGCCAGG - Intergenic
1060233844 9:121846913-121846935 AAAAATCAGAACACAAGGCCGGG + Intronic
1060595809 9:124848004-124848026 AAAAGACAGAAAATAGGGCCAGG - Intergenic
1060843069 9:126810486-126810508 AAAAAAAAAAAAAGACGGCTGGG - Intronic
1061018271 9:127995872-127995894 AAAAAGAAGAAAACACGGCCAGG + Intergenic
1061076845 9:128346704-128346726 AAAAAACAAAATAAAAGGCCGGG + Intronic
1061124646 9:128666766-128666788 AAAAAAAAGAAGATAAGGCCTGG + Intergenic
1061143759 9:128784880-128784902 AAAAAAAAAATTAGAAGGCCAGG + Intergenic
1061179582 9:129016363-129016385 AAAAAAAAAAAGATACGGCCGGG + Intronic
1061825231 9:133254286-133254308 ATGAAACAGAATAGAGAGCCCGG + Intronic
1061827058 9:133265049-133265071 AAAAATAAAAATAGAGGGCCAGG - Intronic
1062356447 9:136166454-136166476 AAAAAACTAAATAAAGGGCCGGG - Intergenic
1062416337 9:136452468-136452490 AAAAAAAAAAAGAGATGGCCAGG + Intronic
1062541243 9:137042550-137042572 AAAAAAAAAAAAAGAAGGCCGGG - Intronic
1203717528 Un_KI270742v1:168154-168176 AAAAAACAGAGTAGAAAACCTGG - Intergenic
1203533697 Un_KI270743v1:10079-10101 AAAAAACAGAGTAGAAAACCTGG + Intergenic
1185590713 X:1275095-1275117 AAAAAAAAAAAGAGCCGGCCGGG + Intronic
1185596528 X:1310371-1310393 AAAAAAAAAAATTGATGGCCGGG + Intronic
1185655115 X:1678253-1678275 AAAAAAAAAAAAAAACGGCCGGG + Intergenic
1185727132 X:2431028-2431050 AAAACAAAAAAAAGACGGCCGGG + Intronic
1185788596 X:2911373-2911395 AAAAAACCCAAAAGAGGGCCAGG + Intronic
1185796078 X:2965602-2965624 AAAACATAGAAAAGACGGGCTGG + Intronic
1185896036 X:3859815-3859837 AAAAAACACAAAAGCCAGCCTGG + Intergenic
1185901155 X:3898241-3898263 AAAAAACACAAAAGCCAGCCTGG + Intergenic
1185906269 X:3936679-3936701 AAAAAACACAAAAGCCAGCCTGG + Intergenic
1186425273 X:9459703-9459725 AAAAAATGGAGTAGAAGGCCAGG + Intergenic
1186523297 X:10224560-10224582 AAAAAACAGAACAGTCCCCCCGG - Intronic
1186567932 X:10684557-10684579 AAAAAAAAAAATAGCCGGCATGG - Intronic
1186963290 X:14760671-14760693 AAAAAACAAAAAAGCCAGCCAGG + Intergenic
1187057750 X:15757078-15757100 AAAAACCAAAGTAGATGGCCGGG + Intronic
1187185773 X:16983798-16983820 CAAAAACAAAATGGAGGGCCGGG - Intronic
1187320177 X:18230747-18230769 GAAAGACAGAAGAGACGGGCGGG + Intergenic
1187379022 X:18783420-18783442 AAAATACAGAATAAAGGGCCAGG + Intronic
1188008387 X:25034199-25034221 AAAAAAAAAAAAAGGCGGCCAGG + Intergenic
1188031439 X:25268460-25268482 AAAAAAAAGAATTCACGGCCAGG - Intergenic
1188031488 X:25268772-25268794 AAAAAAATGAATTCACGGCCAGG - Intergenic
1188409451 X:29853197-29853219 AAAAAAAAAAAAACACGGCCAGG + Intronic
1188883201 X:35515947-35515969 AAAAAACAAAAAAAAGGGCCGGG - Intergenic
1189152199 X:38720169-38720191 AAAAAAAAAAAGAGATGGCCAGG + Intergenic
1189411375 X:40775361-40775383 AAAAGACAGGAAAGAGGGCCGGG - Intergenic
1189782912 X:44533332-44533354 AAAAAACAGTATCCAAGGCCAGG + Intronic
1190099430 X:47509770-47509792 AAAAAAAAAAATAGAAGGCATGG - Intergenic
1190160242 X:48026965-48026987 AAAAAACAGAAGAGACAACAGGG + Intronic
1190296853 X:49032664-49032686 AAAAAAAAAAAAAGATGGCCGGG - Intronic
1190421212 X:50286597-50286619 AAAAAACCGAACTGAGGGCCAGG - Intronic
1190847982 X:54211929-54211951 AAAAAAGAAAATATAGGGCCGGG + Intronic
1190975053 X:55390701-55390723 AAAAAACAAAATAGAAATCCTGG + Intergenic
1191953599 X:66620979-66621001 AAAAAAAAAAATAGCCGGCCAGG + Intronic
1192299911 X:69889443-69889465 AAAAAACAAACCAGAAGGCCAGG - Intronic
1192405849 X:70885594-70885616 AAAAAATAGAAAATAAGGCCAGG + Intronic
1192454000 X:71262492-71262514 AAAAAAAAGAATCCATGGCCAGG - Intergenic
1192456287 X:71278790-71278812 AAAAAAAAAAAAAGACGGCCGGG - Intergenic
1193423495 X:81313056-81313078 AAAAAACAAAAAAAAAGGCCAGG - Intergenic
1193783612 X:85733614-85733636 AAAAAACAGAACAGAAAACCTGG - Intergenic
1194511367 X:94799378-94799400 AAAAAAAAAAAAAGAAGGCCTGG - Intergenic
1195165984 X:102220988-102221010 AAAAAATATAATAGTAGGCCGGG - Intronic
1195192875 X:102466100-102466122 AAAAAATATAATAGTAGGCCGGG + Intronic
1195283046 X:103356337-103356359 AAACAACAGAAAAGACTGACAGG + Intergenic
1195377443 X:104241567-104241589 AAAAAACAAAAAACACCGCCAGG + Intergenic
1195471253 X:105232991-105233013 AAAAAGCTGAATAGTTGGCCAGG + Intronic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1195690341 X:107619101-107619123 AAGAAAAAGAAAAGACGGCCGGG - Intergenic
1195861288 X:109386095-109386117 TAAAAACAGAGCAGAAGGCCAGG - Intronic
1196863998 X:120054176-120054198 ATTAAACAGAATAGACTGCTGGG - Intergenic
1196879101 X:120182154-120182176 ATTAAACAGAATAGACTGCTGGG + Intergenic
1196918822 X:120565386-120565408 ACAAAACAGAAAAAACGGCTGGG + Intronic
1196972724 X:121126848-121126870 AAGAAAAAGAAAAGAAGGCCAGG - Intergenic
1197201277 X:123750925-123750947 AAAGAAAAGAAAAGAAGGCCGGG + Intergenic
1197213630 X:123848301-123848323 AAAAAAAAGAAAAAAAGGCCAGG + Intergenic
1197381452 X:125747276-125747298 AAAAAACACAATAATTGGCCGGG - Intergenic
1197395026 X:125916928-125916950 AGAAAACAGAATAGAGAACCTGG - Intergenic
1197495123 X:127170785-127170807 AAACAACAGAATATAGGGGCAGG + Intergenic
1197564331 X:128063209-128063231 ATAAAACAGAATAGAGAACCTGG + Intergenic
1197747528 X:129941970-129941992 AAAAAAAAAAAAAGAAGGCCGGG + Intergenic
1198422595 X:136482390-136482412 AAAAAAGAAAAGAGAAGGCCAGG - Intergenic
1198727358 X:139691816-139691838 AAAATAAAGAAAAGCCGGCCGGG + Intronic
1199015842 X:142813857-142813879 AAAAATCAGTATACACGGCCGGG - Intergenic
1199368307 X:147015359-147015381 GAAAAACAGTATGGAAGGCCAGG + Intergenic
1199759197 X:150892309-150892331 AAAGAACAGAACAGGAGGCCGGG + Intronic
1200755726 Y:6988361-6988383 AAAAAACAGAAAAGACTCCAGGG + Intronic
1200822568 Y:7602008-7602030 AAAACACAGAAAAGACAGCTGGG - Intergenic
1200874516 Y:8139413-8139435 AAAAAACAGAATAGAAAAACTGG - Intergenic
1200974751 Y:9196767-9196789 AAAAAAAAGAAGTGACAGCCAGG + Intergenic
1201286323 Y:12381739-12381761 AAAAAACCCAAAAGAGGGCCAGG - Intergenic
1201305484 Y:12546381-12546403 AAAAAAGATAAAAGCCGGCCTGG - Intergenic
1201548070 Y:15188645-15188667 AAAAAAAAGAATACTGGGCCGGG + Intergenic
1201552006 Y:15227352-15227374 AAAAAAAAAAAGAGACGGCATGG + Intergenic
1201733216 Y:17228412-17228434 AAAAAAAAGAAAAAAAGGCCGGG - Intergenic
1202237734 Y:22732009-22732031 AAAACACAGAAAAGACAGCTGGG + Intergenic
1202272795 Y:23086720-23086742 AAAAAAAAGAAAAAACAGCCAGG - Intergenic
1202293231 Y:23333962-23333984 AAAAAAAAGAAAAAACAGCCAGG + Intergenic
1202382107 Y:24282282-24282304 AAAAAAGAGAAAAGAAGGCTGGG - Intergenic
1202425792 Y:24720464-24720486 AAAAAAAAGAAAAAACAGCCAGG - Intergenic
1202444997 Y:24949622-24949644 AAAAAAAAGAAAAAACAGCCAGG + Intergenic
1202488677 Y:25387843-25387865 AAAAAAGAGAAAAGAAGGCTGGG + Intergenic