ID: 1025775000

View in Genome Browser
Species Human (GRCh38)
Location 7:64553609-64553631
Sequence CATCAGAGGGAGACAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 831
Summary {0: 1, 1: 1, 2: 7, 3: 167, 4: 655}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025775000_1025775006 -8 Left 1025775000 7:64553609-64553631 CCCTCTCCTGTCTCCCTCTGATG 0: 1
1: 1
2: 7
3: 167
4: 655
Right 1025775006 7:64553624-64553646 CTCTGATGCCAAGCCGAGGCTGG 0: 14
1: 155
2: 627
3: 509
4: 491
1025775000_1025775009 13 Left 1025775000 7:64553609-64553631 CCCTCTCCTGTCTCCCTCTGATG 0: 1
1: 1
2: 7
3: 167
4: 655
Right 1025775009 7:64553645-64553667 GGACTGTACTGCCGCCATCTCGG 0: 150
1: 893
2: 395
3: 401
4: 10880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025775000 Original CRISPR CATCAGAGGGAGACAGGAGA GGG (reversed) Intronic
900146319 1:1160401-1160423 CAAGGGAGGGAGACAGTAGAGGG + Intergenic
900396067 1:2453756-2453778 CATCTGCTGGAGTCAGGAGAGGG - Intronic
900400952 1:2472663-2472685 CTTCAGAGGGAGACACGGGTGGG + Intronic
900641558 1:3690212-3690234 CCCCCGAGGGAGACAGGTGACGG - Intronic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
901108485 1:6776377-6776399 CATCAGAGTGAGACTTGAGATGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901428331 1:9197691-9197713 GAGGAGAGGGAGACTGGAGAGGG - Intergenic
901669434 1:10847004-10847026 CATCAGATGGAGACCCCAGAAGG - Intergenic
901921060 1:12538073-12538095 GATCAGAGGGCAAGAGGAGAGGG - Intergenic
902005129 1:13225906-13225928 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902024354 1:13371700-13371722 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902608173 1:17580851-17580873 GATCTCAGGGAGACAGGAAAAGG - Intronic
902939205 1:19787607-19787629 CATCAGATGGGGAAGGGAGATGG + Intronic
903065501 1:20697118-20697140 CCTCTGGGGCAGACAGGAGAAGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903638170 1:24834869-24834891 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903638180 1:24834901-24834923 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903638198 1:24834958-24834980 CGGGAGAGGGAGACGGGAGAGGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904464759 1:30701193-30701215 CAGCTAAGAGAGACAGGAGATGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904899867 1:33848406-33848428 AATCAGTGGGAGACTGGAGGAGG - Intronic
905277950 1:36831152-36831174 CTTCAGAGTGAGACAGGTGCTGG - Intronic
905446238 1:38030058-38030080 CCTCAAAGGGAGTGAGGAGATGG - Intergenic
906289288 1:44609620-44609642 CAACAGAGGGGGGCAGCAGAGGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906651540 1:47516359-47516381 CTTCACAGGGTGGCAGGAGAAGG - Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907246745 1:53113829-53113851 CATCAGTGTGACACAGCAGAAGG - Intronic
907293710 1:53435054-53435076 CAGCAAAGGGAGATAGGAGTGGG - Intergenic
907392428 1:54166964-54166986 CCTTAGAGGGAAGCAGGAGAAGG + Intronic
907843815 1:58185231-58185253 AATGAGAGGGAAGCAGGAGAAGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909183701 1:72457813-72457835 CATCAGAGAGAGAGAGAGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909946584 1:81670622-81670644 AATCAGAGGCAGTAAGGAGAGGG + Intronic
910860078 1:91734525-91734547 GAGCAGGGGGAGAGAGGAGAAGG - Intronic
911130404 1:94381852-94381874 GCTCAGAGGGAGACAGGTAAAGG + Intergenic
911344221 1:96676831-96676853 CATCAGAGTGAGACATGGCAAGG - Intergenic
912052188 1:105542863-105542885 CTTCACAGGGAGGCAGGAGAGGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913510469 1:119556945-119556967 CTTCAAAGTGAGAAAGGAGAAGG - Intergenic
914707816 1:150185569-150185591 CGTCAGGGGGAGGCAGGAGAAGG + Intergenic
914800131 1:150955382-150955404 CTTTGGAGGGAGACAGGAAAGGG - Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914900724 1:151709789-151709811 CATCTGAAGGAGAGAAGAGAAGG + Exonic
914944668 1:152053402-152053424 CCTCAGATGGAGGCATGAGAGGG + Intergenic
915003087 1:152611488-152611510 CAGCTGAGGGAGGTAGGAGATGG - Intergenic
915279853 1:154814967-154814989 CATGAAAGTGGGACAGGAGAGGG + Intronic
915528482 1:156490227-156490249 CATGAGAAGGAGACCCGAGAGGG - Intronic
915627320 1:157122966-157122988 CAGGTGAGGGAGACAGTAGATGG - Exonic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
916352240 1:163864000-163864022 TTTCAGAGGGAGCCAGCAGAAGG + Intergenic
916594289 1:166228034-166228056 CATCAGTGGTAGACTGGATAAGG - Intergenic
917082309 1:171268669-171268691 CAGGGGAGGGAGAAAGGAGAAGG - Intronic
917219010 1:172707411-172707433 CATCAGAGGGAGCCAGGCTTAGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG + Intronic
917722219 1:177796682-177796704 CTTCAGAGAGGGACAGGAGAGGG - Intergenic
917839739 1:178968068-178968090 CAGGAGAGGGAAACAGAAGAGGG + Intergenic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
919628981 1:199941218-199941240 AATGAGAGAGAGAGAGGAGAGGG + Intergenic
922306689 1:224350665-224350687 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922578208 1:226677424-226677446 CTCCAGAGAGAGACAGCAGAGGG + Intronic
922599408 1:226838280-226838302 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
923321269 1:232835991-232836013 CATCCAAGTGAGACAGGAGAAGG - Intergenic
923776099 1:236979883-236979905 CACCAGAGGAAAGCAGGAGATGG + Intergenic
923956759 1:239031139-239031161 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
924154599 1:241163160-241163182 CATTCGAGGGAGCCAGGAAACGG + Intronic
924743719 1:246813485-246813507 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062907020 10:1186171-1186193 CATCAGAGGAATACAGGCTATGG + Intronic
1062925474 10:1312943-1312965 CACAAGAGGGCGGCAGGAGAGGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063501834 10:6562264-6562286 CTTGTGAGGGAGACAGGAGATGG - Intronic
1063667614 10:8073571-8073593 CCTGGGAAGGAGACAGGAGAAGG + Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064220623 10:13437469-13437491 CATCAGGGAGAGGCAGGAGGGGG + Intergenic
1064884889 10:20100593-20100615 CATATCAGGGAGAGAGGAGAAGG - Intronic
1065297726 10:24292555-24292577 TTTCAGAGGGTAACAGGAGATGG - Intronic
1065624299 10:27614836-27614858 TATGGGAGAGAGACAGGAGATGG - Intergenic
1065840144 10:29695798-29695820 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1067402375 10:45988535-45988557 CTTCAGAGGGACAAAGGTGAAGG - Intronic
1067870725 10:49958168-49958190 CTTCAGAGGGACAAAGGTGAAGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1069741796 10:70689637-70689659 CATCTGGGAGAGACAGGAGGTGG - Intronic
1069878236 10:71576173-71576195 CCTCAGGGGGAGACACGAGGGGG - Intronic
1070013310 10:72498253-72498275 TATCAGTGGGAGAAAGTAGATGG - Intronic
1070617072 10:77977420-77977442 CATCAGCTGGAGACAGGACAAGG + Exonic
1070863830 10:79694027-79694049 CAGCAGAGGGAGCCACGTGATGG - Intergenic
1071187797 10:83063241-83063263 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
1071763892 10:88639963-88639985 CATAAGAAAGAGAAAGGAGAAGG + Intergenic
1071849050 10:89550127-89550149 CACTAGTGGGAGAGAGGAGATGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072999458 10:100276340-100276362 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999462 10:100276353-100276375 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1072999466 10:100276366-100276388 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1074509825 10:114101792-114101814 CATGTGAGGGAGACAGGACAAGG - Intergenic
1074897711 10:117791464-117791486 GGTCAGAGGGAGACTGAAGAAGG - Intergenic
1074944498 10:118268254-118268276 CATCAGAGGATGACCGGAAATGG - Intergenic
1074984123 10:118642251-118642273 CCTCAGAGGGAGACAGTCCATGG + Intergenic
1075342446 10:121658197-121658219 CATCAATGGTAGACAGGATAAGG + Intergenic
1075547700 10:123367828-123367850 AATTAGAGTGAGAGAGGAGAAGG + Intergenic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1076440426 10:130477486-130477508 CATGGCAGGAAGACAGGAGAAGG - Intergenic
1076594115 10:131614739-131614761 CATCAGGGGGTGAAAGGAGGTGG - Intergenic
1076668960 10:132108646-132108668 CACCAGTGGGAGACAGGACCAGG - Intronic
1077553129 11:3211905-3211927 CAGCAAAGGGAGATAGGAGTGGG - Intergenic
1077593790 11:3514007-3514029 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1077751349 11:4973636-4973658 CATGGTAGGGAGAGAGGAGAGGG + Intronic
1077765910 11:5160396-5160418 CAGCAAAGGGAGATAGGAGTGGG + Intronic
1077766731 11:5165807-5165829 CAGCAAAGGGAGATAGGAGTGGG + Intronic
1078026670 11:7701969-7701991 CATTACATGGAGTCAGGAGAAGG - Intronic
1078062858 11:8059680-8059702 CAGCAGAGCAAGGCAGGAGAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078326914 11:10388610-10388632 CTTGTGAGGGAGACAGGACAGGG + Intronic
1078755781 11:14207961-14207983 CATCAGTGGTAGACTGGATAAGG + Intronic
1079545960 11:21632145-21632167 GATCAACGGGAGACAGCAGATGG - Intergenic
1079669340 11:23147485-23147507 AATGAGAGGGAGACATGGGAGGG - Intergenic
1079949382 11:26783227-26783249 CTTCACAGGGCAACAGGAGAGGG - Intergenic
1080864572 11:36181869-36181891 AAACAGAGAGAGAGAGGAGACGG - Intronic
1080993959 11:37578486-37578508 CAGCAAAGGGAGATAGGAGTGGG + Intergenic
1081594848 11:44452074-44452096 CATCAGAGGGAGCCAAGGGGAGG - Intergenic
1081668301 11:44929289-44929311 CATCAGAGATGGCCAGGAGAAGG + Exonic
1081785683 11:45745245-45745267 CAGCCAAGGGAGACAGGAGAGGG + Intergenic
1082171215 11:49007765-49007787 CATCAGTGATAGACAGGATAAGG - Intergenic
1082208371 11:49467102-49467124 CTATAGAGGGAGAGAGGAGAAGG + Intergenic
1082619619 11:55403953-55403975 CATCACAGGGTGGCAGGAGTAGG + Intergenic
1082625517 11:55479581-55479603 CATCACAGGGTGGCAGGAGTAGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083054086 11:59803085-59803107 CAACAGAAGGAAAAAGGAGATGG - Intergenic
1083122690 11:60531421-60531443 CATACTAAGGAGACAGGAGAAGG + Intronic
1083305573 11:61760524-61760546 CCTCAGAGGGACTTAGGAGAAGG + Intronic
1083765713 11:64840500-64840522 CATCCTAGGGACACAGGAGAGGG - Intronic
1083826461 11:65206730-65206752 AGTCAGAGGGGGACAGCAGAGGG - Intronic
1083865259 11:65450316-65450338 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1083865263 11:65450329-65450351 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1084249602 11:67886735-67886757 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1084582470 11:70032516-70032538 GAGCAGAGGGAGGCGGGAGAGGG + Intergenic
1084875077 11:72125092-72125114 CTTCAGAGGGGGAAATGAGAGGG - Intronic
1085040162 11:73322238-73322260 CATCCCAGGGAGACAGGGAAAGG - Intronic
1085151379 11:74255065-74255087 CATCTGGGAGAGACAGGAGGAGG - Intronic
1085252308 11:75151936-75151958 AATCAGACGGGGACAGGTGACGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086115630 11:83246550-83246572 GAGCAGAGAGAGACAGGAGAGGG + Intronic
1086236522 11:84637582-84637604 GATCTAAGGGAGACAAGAGAGGG + Intronic
1086504774 11:87493864-87493886 CCTCAGAAGGTGACTGGAGAGGG - Intergenic
1086507574 11:87521946-87521968 CAGAAGAGGAAGACAGAAGAAGG + Intergenic
1086862742 11:91944212-91944234 CATCAGAGGGAGTTAGGATGAGG - Intergenic
1087120697 11:94571051-94571073 CAGCAGAGTCAGACATGAGATGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087840181 11:102912270-102912292 CAGCAAAGGGAGACAGGTGTGGG - Intergenic
1088107838 11:106225960-106225982 CCTCAGAGGCCCACAGGAGACGG - Intergenic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088366259 11:109043015-109043037 CTTCAAAGGGAGAGAGGAAAAGG + Intergenic
1088833168 11:113555265-113555287 CATCAGAGAGACACAGGTGGTGG - Intergenic
1088887921 11:114022047-114022069 GATCAGAAGAAGACAGGAGAAGG + Intergenic
1089280122 11:117368385-117368407 CATGAGAGGCAGGCAGGAGCTGG + Intronic
1089469083 11:118706520-118706542 GGCCAGAGGGAGACAGGAGAGGG - Intergenic
1089526025 11:119097245-119097267 CACCAGAGTGAGACTGAAGATGG - Exonic
1089576190 11:119446056-119446078 CATCAGAGGTTGCCAGGAGTTGG + Intergenic
1089742773 11:120596456-120596478 CTTCAGAGAGAGACTGGAGAAGG + Intronic
1089770962 11:120802612-120802634 CAGCAGGGGGAGGCTGGAGAAGG + Intronic
1090204015 11:124875091-124875113 CACCTGTGGGAGACAGGACAAGG - Exonic
1090351782 11:126112599-126112621 CATGACAGAGAGACAGGAGCTGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091220401 11:133927097-133927119 CAAAAGAGAGAGACAGGATAGGG + Intronic
1092419889 12:8322134-8322156 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092746849 12:11680788-11680810 TATTAGAGGGAGACAGGCTAGGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093316500 12:17657631-17657653 CCTGAGAGGGACACTGGAGAAGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094775749 12:33725394-33725416 CATAAGATTCAGACAGGAGATGG + Intergenic
1095539855 12:43296922-43296944 CATCAGTGGTAGACTGGATAAGG + Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096129945 12:49150308-49150330 AAGAAGAGGGAGACAGGAAATGG - Intergenic
1096573699 12:52539848-52539870 CTGGAGAGGGAGAGAGGAGATGG - Intergenic
1096751104 12:53759306-53759328 CAGCATAGGGAGAAAGGAGAAGG + Intergenic
1096842848 12:54390060-54390082 TAGCAGAGGGACTCAGGAGAGGG + Intronic
1097241785 12:57580634-57580656 AACCAGATGGAGACAGGACAAGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098508594 12:71284429-71284451 AATCAGAGGAAAAGAGGAGAGGG + Intronic
1099104339 12:78480890-78480912 CATCAGAGGTCTGCAGGAGACGG - Intergenic
1100112159 12:91258979-91259001 AGTCAGAGGGAGTCATGAGATGG + Intergenic
1100371754 12:93975136-93975158 GATCAGAGAGAGACAGTACATGG - Intergenic
1103918646 12:124388508-124388530 CAGCAGGGAGAGAGAGGAGAGGG + Intronic
1103928423 12:124436338-124436360 CAGCTGAGGGAGAGAGGAGGTGG + Intronic
1104258157 12:127157943-127157965 CAGCAAAGGGAGATAGGAGAGGG - Intergenic
1104301426 12:127568543-127568565 GAAGAGAGGGAGAGAGGAGAGGG + Intergenic
1104502595 12:129300949-129300971 TATAAGAGGGAGACAGGAGTGGG - Intronic
1104580297 12:130006671-130006693 CTGCAGCGGCAGACAGGAGACGG - Intergenic
1104609510 12:130216829-130216851 CATCAGTGTGAGCCAGGAGTTGG - Intergenic
1104641500 12:130470116-130470138 CATCTCTGGGAGGCAGGAGAAGG + Intronic
1105357648 13:19673675-19673697 CCTCAGAGGAACACATGAGAAGG + Intergenic
1106255632 13:28019843-28019865 CCCCTGAGGGAGACAGGAGCCGG - Intronic
1106343065 13:28849810-28849832 ACTCAGAGGTAGAGAGGAGAGGG - Intronic
1106364488 13:29065010-29065032 CATCAGTGGAAGACAGAATAAGG - Intronic
1106393517 13:29358614-29358636 CATCAGAGAGTGAGAGGGGATGG + Intronic
1106434264 13:29709832-29709854 CATCAGAAGGAGACTGCAGGAGG + Intergenic
1106521025 13:30497838-30497860 CATCAGTGGTAGACTGGATAAGG - Intronic
1106701044 13:32228921-32228943 CAGCAGATGGAGGCAGGAGATGG + Intronic
1107274813 13:38666497-38666519 CATCATAGGGAGTGGGGAGAAGG - Intergenic
1107279369 13:38716105-38716127 CATCCCAGTGAGACAGGACATGG - Intronic
1107562504 13:41571274-41571296 CGGGAGAGGGAGACGGGAGAGGG - Intronic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1108527307 13:51296857-51296879 CAGCAGAAAGAGAGAGGAGAGGG + Intergenic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1108909259 13:55522518-55522540 TAGGAGAGGGAGACAGAAGAGGG + Intergenic
1109004433 13:56853688-56853710 ATTCAGAGGGAGACATGATAAGG - Intergenic
1111048680 13:82849100-82849122 CATCAGAGTGAGAAAGGAAAAGG - Intergenic
1111489538 13:88953903-88953925 CATCAGCTGAAGACTGGAGATGG + Intergenic
1112657737 13:101470090-101470112 CATCAGATGGCAACAGGAGCTGG + Intronic
1113205647 13:107912933-107912955 CTTCACAGGGAAGCAGGAGAGGG - Intergenic
1113531903 13:111033281-111033303 AAACAGAGAGAGAGAGGAGAGGG + Intergenic
1113613120 13:111661941-111661963 CACCTGTGGGAGGCAGGAGACGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114378291 14:22173220-22173242 CATTAGAGGGGGCCAGGAGTTGG + Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114447566 14:22800996-22801018 CAGCAGATGGTGACAGGAGCTGG - Intronic
1114997846 14:28379716-28379738 CAGAGGATGGAGACAGGAGATGG + Intergenic
1115079272 14:29430996-29431018 CATCACACAGAGACATGAGATGG + Intergenic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116108250 14:40540042-40540064 CATTAGAGGGACCCAGTAGAGGG - Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117412078 14:55459298-55459320 TAGCAGAGGGAGAGAGGACATGG + Intergenic
1117699616 14:58399755-58399777 CATCATAAGGAAACAGGAGTAGG - Intronic
1117728661 14:58698880-58698902 CTTCAGAGGGAGACAGGTGGAGG + Intergenic
1118013243 14:61631572-61631594 CATCAGTGGGGGACAGGAGCTGG + Intronic
1118062181 14:62151591-62151613 CATGAGAGGGAGAAAGGAGGGGG + Intergenic
1120030617 14:79636753-79636775 CTGCAAAGGGAGAAAGGAGAAGG + Intronic
1120250879 14:82061004-82061026 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
1121518024 14:94566640-94566662 CTTGAGAAGGAGAGAGGAGATGG - Intronic
1121549453 14:94787729-94787751 CAACAGTGGGGGACAGGAAACGG + Intergenic
1121741768 14:96257734-96257756 CATCAGAGATAGCTAGGAGAGGG + Intronic
1121914281 14:97821568-97821590 CTTCAGAAGGTGACAGGAGAGGG - Intergenic
1122529009 14:102411619-102411641 CAGCAGAGGGAGATAGGGGTGGG - Intronic
1122548226 14:102536574-102536596 CGTGAGTTGGAGACAGGAGAGGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122569029 14:102681744-102681766 CATCAGAGTGAGGATGGAGATGG - Intronic
1123497057 15:20837733-20837755 CATCTAGGGGTGACAGGAGATGG + Intronic
1123554290 15:21411367-21411389 CATCTAGGGGTGACAGGAGATGG + Intronic
1123590536 15:21848688-21848710 CATCTAGGGGTGACAGGAGATGG + Intergenic
1124013386 15:25857572-25857594 CATCAGAATGACAGAGGAGAAGG + Intronic
1124375842 15:29128204-29128226 CAGCAGAGGGAGAAAGGGCACGG - Intronic
1124483595 15:30097980-30098002 CACCAGGTGCAGACAGGAGAGGG - Intergenic
1124519983 15:30399246-30399268 CACCAGGTGCAGACAGGAGAGGG + Intergenic
1124538671 15:30566978-30567000 CACCAGGTGCAGACAGGAGAGGG - Intergenic
1124698965 15:31894520-31894542 CATCAGAAGAAGGCAGGAAAAGG - Intergenic
1124759979 15:32440604-32440626 CACCAGGTGCAGACAGGAGAGGG + Intergenic
1125731844 15:41896819-41896841 CATCAGGTGGGGACAGAAGAGGG - Exonic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126670614 15:51112205-51112227 CCTCAGGGAGAGCCAGGAGAAGG + Intergenic
1126786486 15:52181004-52181026 CATAGGAGGGAAAAAGGAGAAGG - Intronic
1126939764 15:53754361-53754383 TAGCAGAGGGAGACACGAAAGGG + Intronic
1127018538 15:54717953-54717975 AAAGAGAGGGAGCCAGGAGAGGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127762770 15:62155335-62155357 CAGCAGAGGAATACTGGAGACGG + Intergenic
1128891605 15:71336999-71337021 AATCAGAGAGAGAGGGGAGAGGG + Intronic
1129125648 15:73438657-73438679 TAGCAGAGGGAGACAGGGTAGGG + Intergenic
1129232449 15:74204279-74204301 CATCAGGGGAAGGCAGGAGGAGG - Intronic
1129285742 15:74523094-74523116 AATCAGAGGGAGACAGTCTATGG + Intergenic
1130061640 15:80574659-80574681 CATCATGTGGAGATAGGAGAAGG - Intronic
1130325491 15:82876147-82876169 AATCAAAGGGAGAGAGGCGAGGG - Intronic
1130381478 15:83375920-83375942 CAGCAGAAGGAGCCATGAGAAGG + Intergenic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1131076856 15:89500786-89500808 CAGCAGAGGGAGACAGAAACTGG - Intergenic
1131707845 15:95017862-95017884 CATCTGATGGAGCCAGGAAATGG + Intergenic
1131959000 15:97768371-97768393 CATCAGAGGCAGTAAAGAGAGGG + Intergenic
1132142060 15:99404599-99404621 CATCAGCAAGAGACAGGAGGTGG - Intergenic
1132185130 15:99797277-99797299 CACCAGGTGCAGACAGGAGAGGG - Intergenic
1132431858 15:101767278-101767300 CACCAGGTGCAGACAGGAGAGGG + Intergenic
1202962637 15_KI270727v1_random:138565-138587 CATCTAGGGGTGACAGGAGATGG + Intergenic
1132502554 16:290999-291021 CCTTTGATGGAGACAGGAGAAGG + Intronic
1132891686 16:2207930-2207952 CAACGGAAGTAGACAGGAGAAGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133735751 16:8614354-8614376 GATCAGTGGTAGCCAGGAGATGG + Intergenic
1134225003 16:12382833-12382855 CACCAGAGAGAAGCAGGAGAAGG - Intronic
1134368952 16:13605919-13605941 CATGAGAGCAGGACAGGAGAGGG + Intergenic
1135471167 16:22732481-22732503 CAACAGAGGGAGGCAGATGAGGG - Intergenic
1136074700 16:27808939-27808961 CATCAGTGGGACGCAGGTGAAGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136645407 16:31609355-31609377 CAGCAAAGGGAGATAGGAGTGGG - Intergenic
1137676349 16:50305613-50305635 TATCCGAGGGGGAGAGGAGAGGG - Intronic
1138690163 16:58760105-58760127 CTTCACATGGCGACAGGAGAGGG + Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1138872754 16:60911837-60911859 CACCAGTGGAAGAGAGGAGACGG + Intergenic
1139133355 16:64172629-64172651 CGGGAGAGGGAGAAAGGAGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139712930 16:68790254-68790276 CATCAGGGAGAGAGAGGAGGAGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140357170 16:74316315-74316337 CAGGCGAGAGAGACAGGAGAGGG - Intergenic
1140890222 16:79278764-79278786 CCTGACAGGGGGACAGGAGATGG + Intergenic
1141125257 16:81396595-81396617 CAAGAGAGGGAGCAAGGAGAGGG + Intergenic
1141376596 16:83536447-83536469 CATCACAGGGAGAGAGAAAAGGG + Intronic
1141660361 16:85438047-85438069 CATCTGGGGGAGGCGGGAGAGGG + Intergenic
1141913303 16:87075739-87075761 CCTCAGAGGGTGTGAGGAGACGG + Intergenic
1142242314 16:88953178-88953200 CAGCCGAGGGAGAGAGGCGATGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143008982 17:3855188-3855210 TATCAAAGGGAGAAAGGAGGGGG + Intergenic
1143120355 17:4602834-4602856 GAAAAGAGGGAGCCAGGAGACGG + Intronic
1143689026 17:8545028-8545050 GACCAGAGGGAGAGAGGAGTTGG - Intronic
1143814031 17:9496760-9496782 CATCAGAGGGAGTATGAAGAAGG + Intronic
1144102602 17:11955709-11955731 CATGAGAGGGAGGCAGCATATGG - Intronic
1144397050 17:14854581-14854603 CAGCACAGGAAGAAAGGAGATGG + Intergenic
1144670262 17:17128864-17128886 AAACAGAGGGAGGCAAGAGAGGG - Intronic
1144761143 17:17708152-17708174 CATCAGAGGGTGGCAGCAGGAGG - Intronic
1144959376 17:19036248-19036270 CAGCAGAGGCAGGCAGGAGCTGG + Intronic
1144975783 17:19138276-19138298 CAGCAGAGGCAGGCAGGAGCTGG - Intronic
1145733441 17:27211288-27211310 AGGCAGAGGGAGACGGGAGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147379054 17:40041715-40041737 GAGCAGAGTGAGAGAGGAGAAGG - Intronic
1147450459 17:40500879-40500901 CTTCAGAGGTAGACAGGACTGGG - Intronic
1147661580 17:42119822-42119844 CACCCGAGAGAGAGAGGAGAAGG - Intronic
1147689400 17:42306219-42306241 CCTGAGAGGGAGACAAGAGAGGG - Exonic
1147747650 17:42705159-42705181 CATCAGAGGGGGCCAGCAGCAGG + Exonic
1147820055 17:43236049-43236071 CATCACAGGGAGACAGACGTTGG - Intergenic
1147821369 17:43243448-43243470 CATCACAGGGAGACAGACGTTGG - Intergenic
1147822166 17:43247931-43247953 CATCACAGGGAGACAGACGTTGG - Intergenic
1147823090 17:43253377-43253399 CATCACAGGGAGACAGACGTTGG - Intergenic
1147823860 17:43257977-43257999 CATCACAGGGAGACAGACGTTGG - Intergenic
1147824619 17:43262417-43262439 CATCACAGGGAGACAGACGTTGG - Intergenic
1147827795 17:43280241-43280263 CATCACAGGGAGACAGACGTTGG - Intergenic
1147828903 17:43286402-43286424 CATCACAGGGAGACAGACGTTGG - Intergenic
1147829998 17:43292545-43292567 CATCACAGGGAGACAGACGTTGG - Intergenic
1147834974 17:43323594-43323616 CATCACAGGGAGACAGACGTTGG + Intergenic
1148106782 17:45123178-45123200 CAAGAGAGGGTGAGAGGAGATGG - Intronic
1148542500 17:48492061-48492083 CTTCAAAGTGAGACAGGAGTTGG - Intergenic
1148743531 17:49906313-49906335 CCACAGAGGGACACAGGAGCTGG + Intergenic
1149319261 17:55468064-55468086 CAGCAAAGGGAGATAGGAGTGGG - Intergenic
1150369534 17:64624804-64624826 CAACAGAGCAAGACAGGGGAGGG + Intronic
1151712297 17:75813719-75813741 GGTCAGATGGAGAAAGGAGAAGG - Intronic
1151882885 17:76905444-76905466 GATCAGAGGGAGAGAGGGGTAGG + Intronic
1151948279 17:77331298-77331320 CGTCAGAGGGAGAGAGGAAGAGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152800792 17:82329839-82329861 CAGGAGAGGGAGAGAGGAGGGGG - Intronic
1152841914 17:82574832-82574854 CATCTGAGGGTGAAATGAGATGG + Intronic
1153205261 18:2692429-2692451 GTTGAGAGGAAGACAGGAGAAGG - Intronic
1153565346 18:6413660-6413682 CAACAGAAGGATCCAGGAGATGG + Intronic
1153690297 18:7585640-7585662 CATGAGAGGGAGATAGATGAGGG - Intronic
1154455073 18:14514151-14514173 CATCTAGGGGTGACAGGAGATGG + Intronic
1155433367 18:25785609-25785631 CAGCAGAGGCAGAGGGGAGAGGG - Intergenic
1155733558 18:29192625-29192647 TTTCAGAGGGAAAGAGGAGATGG - Intergenic
1157279444 18:46335969-46335991 CCTCAGATGGAGACAGGAAATGG - Intronic
1158184607 18:54757213-54757235 CATCAGAGTCAGACAGAATAGGG + Intronic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1158868961 18:61665752-61665774 CATCTGAGGGAGAAGGGGGAAGG - Intergenic
1159751921 18:72313348-72313370 CATCAGTGGTAGACAGGACAAGG + Intergenic
1160358242 18:78246847-78246869 CATCAGTGGGAAACAGGACGTGG + Intergenic
1161071927 19:2266729-2266751 CATCAGAGGCAGGCAGGAGGAGG + Intronic
1161761946 19:6180102-6180124 TATAAGAGGGAAGCAGGAGAGGG - Intronic
1162367270 19:10257092-10257114 CAGGAGAGGGTGACAGGAGGTGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163209333 19:15829076-15829098 CAGCGAAGGGAGATAGGAGAGGG - Intergenic
1163555488 19:17989997-17990019 CTTCAGAGGGAGGCAGATGATGG + Intronic
1163928157 19:20364702-20364724 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
1164003565 19:21129450-21129472 CAGCAAAGGGAGATAGGAGCGGG + Intergenic
1164004328 19:21134883-21134905 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
1164219909 19:23184025-23184047 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1164258499 19:23549783-23549805 CAGCAAAGGGAGATAGGAGTGGG - Intronic
1164853176 19:31501294-31501316 AATGAGAAGGGGACAGGAGAGGG - Intergenic
1165422986 19:35731661-35731683 CAGCAGAGGCAGAGAGGAGATGG + Intronic
1166126958 19:40720704-40720726 CAGCAGAGGGGGTCAGGAGGAGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166716796 19:44973568-44973590 CAGCAGAGGCTGACAGGAGGTGG + Intronic
1167229032 19:48270062-48270084 CAGCGAAGGGAGATAGGAGAGGG - Intronic
1167417012 19:49379589-49379611 AATCAGAGGAAGTTAGGAGAGGG + Intergenic
1167647384 19:50713086-50713108 CATCTGAGGGAGAGAAGGGAGGG + Intronic
1167657810 19:50777623-50777645 CATGAGAGAGAGACAGAACATGG - Intergenic
1167697896 19:51025736-51025758 CAGGTGAGGGAGAGAGGAGAGGG - Intronic
1167729497 19:51243139-51243161 GAGGAGAGGGAGCCAGGAGAAGG - Intronic
1167920395 19:52778644-52778666 CATCACTGGGTCACAGGAGATGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168312030 19:55465214-55465236 CAGCAGAGTGAGGGAGGAGAGGG + Intergenic
1168402793 19:56095604-56095626 CAACAGAGGAAGGCAGGAGAAGG - Intronic
925134960 2:1520398-1520420 CAGCAGAGAGAGACACGGGAGGG + Intronic
925142293 2:1558653-1558675 GATCAGAAGGAGGCAGGAGTGGG - Intergenic
925142299 2:1558681-1558703 GATCAGAAGGAGGCAGGAGTGGG - Intergenic
925142305 2:1558709-1558731 GATCAGAAGGAGGCAGGAGTGGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925832378 2:7909211-7909233 GCTTAGATGGAGACAGGAGAAGG + Intergenic
925881707 2:8358116-8358138 CACAAGGGAGAGACAGGAGATGG + Intergenic
926190351 2:10723016-10723038 GGTCAGGGGGAGACAGGAGAGGG + Intronic
926909959 2:17843361-17843383 CATGAGAAGAAGACGGGAGAGGG + Intergenic
927140775 2:20129508-20129530 CAGGTGAGGGAGACAGGAGGCGG - Intergenic
927148933 2:20184858-20184880 GAACAGAGGGACACTGGAGACGG - Intergenic
927421474 2:22936954-22936976 TATCAGAGACAGACAGGTGAGGG + Intergenic
927510563 2:23641491-23641513 CCTCTGAGGGAGGCAGGGGAAGG - Intronic
927712145 2:25332638-25332660 AATCAGAGGGAGCCAGGGCACGG - Intronic
927783201 2:25955377-25955399 CAACAGGGGGAGGCAGGAGGCGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928725910 2:34172917-34172939 CTTCACAGGGTGGCAGGAGAGGG + Intergenic
928823613 2:35392136-35392158 CATGAGAGGGAAAGAGGACAGGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930094548 2:47557017-47557039 CATCTGTGGGAGGCTGGAGAAGG + Intronic
931113308 2:59137090-59137112 CATCAGAAAGAGACAGGATAAGG + Intergenic
931360693 2:61575321-61575343 CTCCAAAGGGAGAAAGGAGAAGG - Intergenic
931630789 2:64296666-64296688 CATCATAGGGAGGAAGGGGAGGG + Intergenic
931751856 2:65338148-65338170 CGGGAGAGGGAGACGGGAGAGGG - Intronic
931751880 2:65338225-65338247 CGGGAGAGGGAGACGGGAGAGGG - Intronic
931759091 2:65400697-65400719 CATCAGAGCAAGAAAGGAAAAGG - Intronic
932399214 2:71468156-71468178 CATCAGGTGGACACTGGAGAAGG - Intronic
932568175 2:72922498-72922520 CATCACAGGGAGATGGGTGAGGG - Intronic
932586375 2:73032296-73032318 CAGCAGAGGCACAGAGGAGATGG - Intronic
932672046 2:73746324-73746346 CACAGGAGGGAGACAGGAGGGGG + Intergenic
932672989 2:73754282-73754304 CATCACAGGGAGACAGGGTCAGG - Intergenic
933447303 2:82398376-82398398 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
933934544 2:87191463-87191485 CAGCAGAGGGAGAAAGGTTAAGG - Intergenic
934784865 2:96997681-96997703 CATGAGAGAGAGACGGGAGGGGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935671719 2:105561899-105561921 CATCTGAGAGAGGCTGGAGATGG - Intergenic
936001310 2:108832921-108832943 GATAAGAGGGAGACAGGAAATGG + Intronic
936254900 2:110903211-110903233 GACCAGAGGGAGAGGGGAGAAGG + Intronic
936358599 2:111774433-111774455 CAGCAGAGGGAGAAAGGTTAAGG + Intronic
936870540 2:117130872-117130894 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938419475 2:131132882-131132904 CGCCTGCGGGAGACAGGAGAGGG - Exonic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938989586 2:136614166-136614188 TATCCGAGGGAGACATGGGAAGG + Intergenic
939781590 2:146457133-146457155 CATCAGTGGTAGACTGGATAAGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940726980 2:157345323-157345345 CAGCAAAGGGAGATAGGAGTGGG - Intergenic
941087635 2:161136176-161136198 CAGATGAGGGAAACAGGAGAAGG - Intergenic
941226723 2:162858664-162858686 TCACAGAGGGAGACAGGTGAGGG + Intergenic
941528996 2:166641572-166641594 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
941663178 2:168216250-168216272 AATCAGAGGGAGACAGATGAAGG + Intronic
942247774 2:174023728-174023750 GGTCATAGGAAGACAGGAGAAGG + Intergenic
942687193 2:178545751-178545773 AATCAGGGGGAGAAGGGAGAAGG - Intronic
942783279 2:179671603-179671625 CATCATAGGCACACAGTAGAAGG + Intronic
942937431 2:181575115-181575137 CATCAGTGGGAGAAGGGAGAAGG - Intronic
943471880 2:188304677-188304699 CATCAGAGGGACAAAAAAGAAGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944906301 2:204265222-204265244 AATCAGAGGGAGACAGAAAGGGG - Intergenic
945090674 2:206173005-206173027 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
945090684 2:206173037-206173059 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945882599 2:215341957-215341979 CTTCAGAGGGCGGCAGGAGAGGG + Intronic
945970639 2:216227623-216227645 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
946315276 2:218907274-218907296 GAATAGAGGGAAACAGGAGAAGG + Intergenic
946412266 2:219521364-219521386 GATCAGAGGGGGACAGGACGTGG - Intronic
946488657 2:220126199-220126221 AAAAAGAGGGAGACAGGAGGAGG + Intergenic
947004810 2:225498846-225498868 CATTAGAGGGAAAAGGGAGATGG + Intronic
947424657 2:229972539-229972561 GAACAGAGGGAGAGAGGAGGAGG + Intronic
947610946 2:231524880-231524902 CCTCAGAGGGAAACAGCAGGAGG - Exonic
947909065 2:233789832-233789854 CATCTGCAGGAGACAGAAGAGGG - Exonic
948586110 2:239020768-239020790 CCCCAGAGGGAGGCAGGAGGGGG - Intergenic
1168774701 20:438155-438177 CATCAGATGGACACAGAAGGAGG - Exonic
1168917580 20:1503782-1503804 CATCATAGGCAGACACTAGAGGG - Intergenic
1169085330 20:2822566-2822588 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085334 20:2822579-2822601 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1169386795 20:5156753-5156775 CATGAGGGGGAGCCAAGAGATGG - Intronic
1169422823 20:5473435-5473457 CATCCGAGGGAGGGAGGAGAGGG + Intergenic
1169426603 20:5502040-5502062 CATCCAAGGGAGGGAGGAGAGGG - Intergenic
1170051302 20:12148574-12148596 GGTCTGAGGGAGACAGGAGCAGG + Intergenic
1170288257 20:14736312-14736334 TGCCAGAGGGAGACAGGAGTGGG + Intronic
1170445767 20:16425963-16425985 CTTCTCATGGAGACAGGAGAGGG + Intronic
1170525355 20:17230175-17230197 CATCAGAGCAAGGAAGGAGAAGG - Intronic
1170786353 20:19470974-19470996 CCTCAGAGGGAGACGGCACAAGG + Intronic
1172514144 20:35521515-35521537 GAGGAGAGGGAGAGAGGAGAGGG + Intergenic
1172553877 20:35823746-35823768 GATCAGTGGGTGACAGGAGCTGG - Intronic
1173103291 20:40107559-40107581 GATCAGAGGTTGCCAGGAGAAGG + Intergenic
1173155729 20:40606975-40606997 TATAAGAGGGAGACAGAAGGAGG - Intergenic
1173225823 20:41161940-41161962 CATGAGAGGGAGGAAGGAGGAGG - Intronic
1173622950 20:44450494-44450516 CATCACAGGGAGGCAGGAACAGG - Intergenic
1173876648 20:46376481-46376503 CATCAGAGGGACAAAGGAGGAGG - Intronic
1174002208 20:47383048-47383070 CAGAAGAGGAAGGCAGGAGAAGG + Intergenic
1174959285 20:55136781-55136803 GATCTGGGTGAGACAGGAGAAGG + Intergenic
1175217458 20:57399111-57399133 CCTCAGAAGGCGACAGGAGCTGG + Intronic
1175239366 20:57535456-57535478 GGTCAGAGGGAGGCTGGAGAAGG + Intergenic
1175279077 20:57790732-57790754 GTTCAGAGGGAGACAGGATGGGG + Intergenic
1175639846 20:60619744-60619766 CTTCAGAGGGAGAGTGGAGTTGG + Intergenic
1175743577 20:61437393-61437415 CGTCACAGGGAGACAGAAGATGG - Intronic
1176819093 21:13639127-13639149 CATCTAGGGGTGACAGGAGATGG - Intronic
1177261767 21:18738541-18738563 GATCAGATGGAGGAAGGAGAAGG + Intergenic
1177376245 21:20274096-20274118 CAGCAAAGGGAGATAGGAGTGGG - Intergenic
1178029027 21:28503869-28503891 CATCAGTGGGAGATATGACAAGG + Intergenic
1178098539 21:29241068-29241090 CAGCAGTGGGACACAGGACAAGG - Intronic
1178381923 21:32117142-32117164 CAAAAGAGGGGGACAGGAAAAGG + Intergenic
1178409385 21:32350920-32350942 CAGCTGAGGGAGACAGCAAAAGG + Exonic
1178701758 21:34839839-34839861 AATCAGAAGCAGGCAGGAGAAGG - Intronic
1179384111 21:40925707-40925729 TGTAAGAGGGAGACAGGTGATGG + Intergenic
1179532404 21:42028867-42028889 CAGCATAGGGAGGCTGGAGAGGG + Intergenic
1179614562 21:42573391-42573413 CCTCAGAGGGAGACAGCACAGGG - Intronic
1181437929 22:22921192-22921214 CCCCAGAGGGAGAGGGGAGAGGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182043828 22:27259120-27259142 CAACAGAGAGAGAAGGGAGAAGG - Intergenic
1182314124 22:29432332-29432354 CATCACAGGGTGATAGGAGGGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183225706 22:36548628-36548650 GATCAGATGGGGACAGGAAATGG + Intergenic
1183261935 22:36800754-36800776 CATTAGAGGGCCACAGGGGATGG + Exonic
1183270122 22:36856720-36856742 CAGCAGAGGGAGACAGAAAAGGG + Intergenic
1183637848 22:39075815-39075837 CAGCGAAGGGAGATAGGAGAGGG + Intronic
1183871960 22:40746582-40746604 CGGGAGAGGGAGACGGGAGAGGG + Intergenic
1183949280 22:41343651-41343673 CATCACAGGTAGACAGAACAGGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184299330 22:43546462-43546484 TATCAGTGGGAGCCAGAAGATGG + Intronic
1184927946 22:47657290-47657312 CAGCAGAGGGGGACAGCAAAGGG - Intergenic
1185000946 22:48245149-48245171 CATCACAGTGAACCAGGAGAAGG + Intergenic
1185165925 22:49262234-49262256 CATGTGAGGCAGAGAGGAGATGG - Intergenic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
949721234 3:6992784-6992806 CATCAGAGGGTGGGAGGAGAAGG - Intronic
949950083 3:9221761-9221783 CAAAAGATGGAGTCAGGAGAGGG - Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950798466 3:15530513-15530535 CATCAGAAGAAGACAGGGGAGGG - Intergenic
951299133 3:20972921-20972943 CAGCAGAGGGAGATAGGGGTGGG + Intergenic
951715814 3:25644707-25644729 CATCAGGGGGTGATGGGAGATGG + Intronic
951775587 3:26307073-26307095 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
952253661 3:31677602-31677624 CATCTGAGGGCCTCAGGAGAGGG + Intronic
953619758 3:44522954-44522976 CAGCGAAGGGAGATAGGAGAGGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954886939 3:53882912-53882934 GATCATAGGGGGACAGGACAAGG - Intergenic
955392652 3:58532679-58532701 CATAAGAGAGAGACATGAGCCGG - Intronic
956255477 3:67278912-67278934 CATCAGAGGGTTAGAGCAGAAGG + Intergenic
956399340 3:68860483-68860505 CAACAGAGAGAGAGAGGAAAAGG - Intronic
956849389 3:73214410-73214432 AATCACATGGAAACAGGAGAGGG + Intergenic
957023662 3:75153470-75153492 CATAAGAGTTAGGCAGGAGAAGG - Intergenic
957063843 3:75504691-75504713 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
957083948 3:75663298-75663320 CAGCAGAGGGGGAGAGAAGAAGG + Intergenic
957154746 3:76533677-76533699 CAGCAAAGGGAGATAGGGGAGGG + Intronic
957155364 3:76537780-76537802 CAGCAAAGGGAGATAGGGGAGGG + Intronic
957316344 3:78581313-78581335 CAGCAGAGGGAGATAGGGGTGGG + Intergenic
957317652 3:78588573-78588595 CAGCAGAGGGAGATAGGGGTTGG + Intergenic
957552585 3:81726366-81726388 AGTAAGAGGGAGACAGGAAATGG + Intronic
958084555 3:88789731-88789753 GAGCAGAGGGACACAGGGGATGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959584819 3:108016121-108016143 CATCACAGGAAGAGAGGGGATGG - Intergenic
960073466 3:113458163-113458185 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073470 3:113458176-113458198 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073474 3:113458189-113458211 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073478 3:113458202-113458224 CGGGAGAGGGAGACGGGAGAGGG - Intronic
960073482 3:113458215-113458237 GAGGAGAGGGAGACGGGAGAGGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960814426 3:121658345-121658367 CATCTGAGAGTGACCGGAGATGG + Exonic
961669211 3:128516869-128516891 CATAAGAGGGAGGCAGAAGTGGG + Intergenic
961897577 3:130181327-130181349 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
962611236 3:137078164-137078186 CATGGGAGGGACAAAGGAGAAGG - Intergenic
962815591 3:138994955-138994977 CATCAAGGGGAGAAAGGAGAAGG - Intergenic
963229042 3:142891415-142891437 CCTCACAGGGTGATAGGAGAAGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963525403 3:146409360-146409382 CTTCAGAGGGAGGCAGTACAGGG + Intronic
963587358 3:147209250-147209272 AATCAAAGGGAGAAAGAAGAGGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964300766 3:155282879-155282901 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
965456746 3:168910875-168910897 CATCAATGGAAAACAGGAGAAGG - Intergenic
965710694 3:171553887-171553909 AATCAGAAGGAGACAGAAGGAGG + Intergenic
966324129 3:178735267-178735289 GGACAGAGGGACACAGGAGATGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967144715 3:186596957-186596979 AATCAGGGGGAGAAACGAGATGG + Intronic
967984058 3:195082380-195082402 CACCAGAGGGAGAGAGAAGATGG - Intronic
968356137 3:198109052-198109074 CAGCAGAGGGGGAGACGAGAAGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968540082 4:1163566-1163588 CAGCACAGAGAGACAGGAAATGG - Intergenic
969007743 4:4034893-4034915 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
969228727 4:5815449-5815471 CCTCATAGGGAGACGGGAAATGG + Intronic
969348087 4:6581668-6581690 CAGCAAAGGAAGACAGGAGCAGG + Intronic
969475115 4:7417930-7417952 CATAAGAGTGAGCCAGCAGAAGG + Intronic
969664478 4:8549242-8549264 CATCAGGGCTGGACAGGAGAAGG + Intergenic
969714459 4:8861561-8861583 CATCGGAAGAAGACAGGCGAAGG + Intronic
969745870 4:9071169-9071191 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
970107833 4:12605013-12605035 CATTATAGGGAAGCAGGAGAAGG - Intergenic
970148943 4:13068856-13068878 CTGCAGAAGGAGCCAGGAGATGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970538340 4:17052784-17052806 CCTCAGGGTAAGACAGGAGAGGG + Intergenic
970812297 4:20108618-20108640 CATTAGAGGGATAAAGAAGATGG - Intergenic
970874556 4:20854491-20854513 GAAGAGTGGGAGACAGGAGAGGG + Intronic
971016784 4:22497109-22497131 GAACAGAGGGAGACAACAGAGGG + Intronic
971097068 4:23418580-23418602 GATCCGAGGAAGACTGGAGAAGG + Intergenic
971366065 4:25978046-25978068 AATCAGAGAGAGACAGGAGCAGG - Intergenic
971382310 4:26110262-26110284 CAGCATAGGGGGACAGGAGGAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
973810270 4:54562582-54562604 AATCAGAGGGAGCTGGGAGATGG + Intergenic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
974329283 4:60455783-60455805 CCTCAGAGGGAGGCAGGCCAGGG - Intergenic
975250534 4:72173484-72173506 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
975658926 4:76669029-76669051 CATCACATGGAGACGGGATAGGG + Intronic
975683803 4:76900189-76900211 CAAGAGAGAGAGAGAGGAGAAGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
976668498 4:87626229-87626251 CAGCAGGGAAAGACAGGAGATGG - Intergenic
977161014 4:93635361-93635383 TCTCAAAGGGAGACAGGAGTAGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978663593 4:111155578-111155600 CACCAAATGGGGACAGGAGAAGG - Intergenic
978742457 4:112152605-112152627 CAACAGAGACAGAAAGGAGATGG - Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979362854 4:119784630-119784652 CTTCACATGGTGACAGGAGAGGG + Intergenic
979858366 4:125662988-125663010 CTTCATAGGGAGAGGGGAGAAGG + Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980454588 4:133022666-133022688 CAGAAGAGGGAGCCAGGAGCAGG + Intergenic
981661825 4:147176106-147176128 CATCAAAAAGAGCCAGGAGAGGG + Intergenic
982015097 4:151145545-151145567 CAGCAAAGGGAGACAGGAGTGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983688450 4:170438433-170438455 TATGAGAGGAAGACTGGAGATGG - Intergenic
984388249 4:179092757-179092779 CAAAAGAGGAAGACATGAGAAGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984953456 4:185023313-185023335 AGACAGAGGGAGACAGGAGCGGG - Intergenic
985002802 4:185502675-185502697 CATCAGAGAGAAACACGGGATGG - Intronic
985436520 4:189935466-189935488 CATCATAGGGAGCCAGGTGTGGG - Intergenic
985761547 5:1751693-1751715 CAGCAGCAGGAGACAGGAGGAGG - Intergenic
986122756 5:4857429-4857451 CATCAGAGGGTGATGGGAGATGG - Intergenic
986122831 5:4857784-4857806 CATCAGAGGGTGCTGGGAGATGG - Intergenic
986348865 5:6858733-6858755 TACCAGTGTGAGACAGGAGAGGG + Intergenic
986664638 5:10090098-10090120 CAGAAGAGGGAGGCAGAAGAGGG + Intergenic
986781661 5:11071966-11071988 AATCTGAGGAAGAAAGGAGATGG + Intronic
987936972 5:24479433-24479455 CATTAGAGGGAGCCAGGAGGTGG + Intergenic
988155989 5:27449287-27449309 CTTCACAGGGTGGCAGGAGAGGG - Intergenic
989491011 5:42053552-42053574 CAACAGAGTGAGCTAGGAGAAGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990504734 5:56433104-56433126 CAGCAGAGGGAGAGAGGGGTGGG + Intergenic
991158712 5:63469504-63469526 CATAAGGAGGAGACAGGAGTGGG + Intergenic
991272190 5:64796957-64796979 GGGCAGAGGGAGAGAGGAGAAGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
993517671 5:88857713-88857735 CTTCACAGGGTGGCAGGAGAGGG - Intronic
993923542 5:93837347-93837369 CATCAGTGGTAGACTGCAGAAGG - Intronic
994081392 5:95711685-95711707 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
994179707 5:96750731-96750753 CAGCAGAGAGTGACAGGAGGAGG - Intronic
994980272 5:106865798-106865820 AATCATGGGGAGACAGGAAATGG + Intergenic
995469380 5:112484419-112484441 CATCCCAGGGAGAGAGGAGCGGG + Intergenic
995926551 5:117381841-117381863 CAACATAGAGAGGCAGGAGAGGG - Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000372896 5:160554273-160554295 TATGAGAGGGAGACAGAAGAAGG - Intergenic
1000746280 5:165037778-165037800 CAGCAGACTGAGACAGCAGAAGG - Intergenic
1001113309 5:168917036-168917058 CTTCAGAGGTACAAAGGAGACGG + Intronic
1001131985 5:169071924-169071946 CGTCACAGAGAGACAGTAGAAGG + Intronic
1002439630 5:179257560-179257582 CATCAGCGGGAGCCAGCAGCGGG - Intronic
1002556971 5:180049821-180049843 ATTCAGAGGCAGAAAGGAGAGGG - Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1004020237 6:11770436-11770458 CAGGAAAGGGAGAGAGGAGAGGG + Intronic
1004798765 6:19120679-19120701 CATGAGAGGGAGAAAGGAAGAGG + Intergenic
1005167764 6:22944738-22944760 CATCAGAGGAAGATGGAAGAGGG + Intergenic
1005206824 6:23414499-23414521 CAACAGAAGGACACTGGAGAGGG + Intergenic
1005738939 6:28773362-28773384 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1005814916 6:29542660-29542682 CATCTGAGACAGGCAGGAGAGGG + Intergenic
1005964894 6:30720337-30720359 TCTGAGAGGGAGAAAGGAGAGGG - Exonic
1006167186 6:32071919-32071941 CAGCAGAGGGAGTGAAGAGAAGG + Intronic
1006193525 6:32223507-32223529 GATGAGAGGGAAGCAGGAGATGG - Intronic
1006393287 6:33771501-33771523 CATCTGCGGCAGGCAGGAGAGGG - Exonic
1006507918 6:34502357-34502379 AAACAGAGGGAAACAGGGGAAGG + Intronic
1007079007 6:39085565-39085587 AAACACAGGGAGACAGGAGATGG - Intronic
1007725721 6:43914563-43914585 CATCATGGGGGGACAGGGGAGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008695712 6:54033658-54033680 CATGAGAGGGATATAGGTGAGGG - Intronic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1010336166 6:74685677-74685699 CATCAGTGGTAGACTGGATAAGG + Intergenic
1012710821 6:102602119-102602141 CATCAGTGAAAGACCGGAGAAGG + Intergenic
1013086813 6:106864149-106864171 AATCAGAGTGGGTCAGGAGAAGG + Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1013758024 6:113483816-113483838 CAAAAGAGGGAGCCTGGAGATGG - Intergenic
1014214164 6:118736840-118736862 CATCAGAGGCAGAGAAGGGAAGG + Intergenic
1014987443 6:128029202-128029224 CAAGAGAGGGAGACAGGAGAGGG - Intronic
1015093242 6:129384670-129384692 CAACAGGGGTAGACTGGAGATGG + Intronic
1015877456 6:137837442-137837464 GAACAGTGGGAGACAGGCGAGGG - Intergenic
1016063597 6:139655748-139655770 CAACAGAGAGGGAAAGGAGAAGG + Intergenic
1016295544 6:142569747-142569769 CATGAGAGGGAGGCAGGAAGAGG + Intergenic
1016873238 6:148839296-148839318 CCTCAGAGGGTTAAAGGAGAGGG - Intronic
1017243960 6:152201776-152201798 CAGCAGAGGCACACAGGTGACGG + Intronic
1017682401 6:156877423-156877445 CACCTGAAGGAAACAGGAGAGGG - Intronic
1018202429 6:161407958-161407980 CAGCGAAGGGAGATAGGAGAGGG - Intronic
1018765393 6:166928963-166928985 GCTCTGACGGAGACAGGAGATGG + Intronic
1018972001 6:168536393-168536415 CTTCAGAGGCTGACAGGAGCTGG + Intronic
1019117881 6:169779958-169779980 CAGCCGAGGGAGACTGGAGCTGG - Intronic
1019174187 6:170151713-170151735 CAGCAGAAGGAGACAGGGGCAGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020328267 7:6993024-6993046 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022190199 7:28010209-28010231 AATCAGGGGGTGAAAGGAGAGGG + Intronic
1022479704 7:30734732-30734754 CAGCAGAGGGAGCTAGGAGAGGG - Intronic
1023878562 7:44306124-44306146 CATGGGAGTGAGAGAGGAGAGGG + Intronic
1024043023 7:45569415-45569437 CATCAGATGAAGTCAGGAGTTGG + Intergenic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026045767 7:66904409-66904431 CATCAGCGGGAGGCAGGAGCTGG - Intergenic
1026180589 7:68036004-68036026 CATCAGAGGGCAAGTGGAGAGGG - Intergenic
1026277462 7:68892578-68892600 CATCACTGTGGGACAGGAGAGGG - Intergenic
1026307530 7:69154831-69154853 CTTCAGGGGGAGAAAGGAGGCGG + Intergenic
1026479469 7:70765426-70765448 CCTCCCAAGGAGACAGGAGAAGG - Intronic
1028963384 7:96774851-96774873 CATGATAGGGAGAGAGAAGAAGG + Intergenic
1029661165 7:101963088-101963110 CAGCAGGGGGAACCAGGAGATGG - Intronic
1031003596 7:116446586-116446608 CATCAGAGGGAGACGTAAGGAGG - Intronic
1031432387 7:121688059-121688081 TATAAGAGGGAGAGAGGAGCAGG + Intergenic
1032368913 7:131327358-131327380 AGTCAGATGGAGACAGGAAAAGG - Intronic
1032486595 7:132292271-132292293 AATCAGAGGGAGGCTGGAGGTGG + Intronic
1033007249 7:137579985-137580007 CATCAGAGTGAGAAGGGAGCAGG - Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033223375 7:139543262-139543284 CCTGAGAGGGGGACAGGAAAGGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033404427 7:141058096-141058118 CACCAAAGGAAGACAGAAGATGG - Intergenic
1034256525 7:149727753-149727775 CAACAGAGGGAGCCGGGAGTTGG - Intronic
1034420247 7:150986782-150986804 CAGGAGAGGGAGACAGGAGGAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1036368358 8:8141091-8141113 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
1036483142 8:9154867-9154889 AAAGAGAGGGAGACGGGAGAGGG + Intronic
1036724472 8:11207669-11207691 CATCATAGGCAAAAAGGAGAGGG + Intergenic
1036765927 8:11549355-11549377 CATCCAGGGGAGCCAGGAGAAGG - Intronic
1036882530 8:12524551-12524573 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1037256006 8:16954599-16954621 CATCAGTGGTTGCCAGGAGATGG + Intergenic
1037356037 8:18020439-18020461 GATTAGAAGGTGACAGGAGAAGG - Intronic
1037437553 8:18879293-18879315 GATAAGAGGGAGACAGGGCAAGG + Intronic
1037629225 8:20637831-20637853 CCTCAGAGAGAGACAGCACATGG - Intergenic
1038033504 8:23665388-23665410 CATAATAGGGAAACTGGAGAGGG - Intergenic
1038243561 8:25832571-25832593 CATCAGAGCGGCAGAGGAGAAGG - Intergenic
1038448137 8:27618283-27618305 CATCAGTGGCAGACTGGATAAGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038687715 8:29733800-29733822 CATCAGAGGGTGAAGGGAGAGGG - Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039163066 8:34644179-34644201 CAGCAGAGGGAGACAGAAAGAGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040087487 8:43360653-43360675 CATCTGGGGGTGACAGGAGATGG - Intergenic
1040737386 8:50525200-50525222 CATTATAGGGAGAAAGGAGTGGG - Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040823881 8:51596282-51596304 CATCAGTGGTAGACTGGATAAGG - Intronic
1041357877 8:57021237-57021259 AAGGAGAGGGAGACGGGAGAGGG - Intergenic
1041379882 8:57243723-57243745 CATCACATGGACACAGGACATGG + Intergenic
1041495553 8:58481915-58481937 CTTCAGAGGAAAACAGGAGTGGG + Intergenic
1043517127 8:81005173-81005195 CATCTGAGAGAGACAGGACATGG + Intronic
1043958713 8:86390694-86390716 GACGAGAGGGAGACGGGAGAGGG + Intronic
1044470891 8:92565818-92565840 AATCAGCAGGAGACAAGAGATGG + Intergenic
1044767908 8:95596865-95596887 CATGAGAGGGAGGGTGGAGATGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046223944 8:111251961-111251983 CTTCACAGGAAGACAGGAGAGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046703444 8:117426195-117426217 CAACAGAGGGAGACCAAAGAAGG - Intergenic
1046930417 8:119836409-119836431 TATAAGAAGGAGAAAGGAGAAGG + Intronic
1047314830 8:123723171-123723193 CATCAGTGGGAGGCAGGGGGAGG + Intronic
1047630105 8:126697573-126697595 AATCCTAGGGAGACAGGACAAGG - Intergenic
1047794787 8:128243521-128243543 CATCAGAGGGACCCAGGAGGAGG + Intergenic
1048104714 8:131395451-131395473 CATCACAGGCAGAACGGAGAGGG - Intergenic
1048329696 8:133463413-133463435 GATCAGAGTGAAACAGGATAAGG - Exonic
1048383116 8:133885843-133885865 CAAGAGAGAGAGACTGGAGAAGG + Intergenic
1048586425 8:135778305-135778327 AAGCAGATGAAGACAGGAGAGGG + Intergenic
1049543017 8:143216981-143217003 CAGCAGAAGGAGGAAGGAGAAGG - Intergenic
1049551941 8:143264076-143264098 CATCAGAGAGAGATAGGGGTTGG - Intronic
1049844543 8:144793478-144793500 CGTGAGAAGGAGACAGGAGAGGG + Intergenic
1050037648 9:1454212-1454234 CAGCAGAGGCAGTGAGGAGAGGG + Intergenic
1050144622 9:2553541-2553563 TTTCAGAGGGAGGCAGGAGATGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051222409 9:14863557-14863579 CACTAGAGGGAAACAGGATACGG + Intronic
1051285727 9:15493687-15493709 CTTCACAGGGACCCAGGAGAGGG + Intronic
1051953684 9:22663763-22663785 CAGCAAAGGGAGATAGGAGTGGG + Intergenic
1052664683 9:31479831-31479853 AGTCAGAGAGAGAGAGGAGAGGG - Intergenic
1052802707 9:32984859-32984881 TAGCAGAGGGATACAAGAGAAGG + Intronic
1053131227 9:35616934-35616956 TATCAGACGGAGAGAGGGGAAGG + Intronic
1053139513 9:35673976-35673998 CAACAGAGGGAGCCAGGGGCTGG - Exonic
1053289103 9:36868377-36868399 CCTCAGACGCAGCCAGGAGACGG + Intronic
1054823169 9:69544304-69544326 CATCAAAGAGTGACAGGGGAAGG - Intronic
1054910672 9:70452470-70452492 CTTCAGAAGGTGACAGAAGAAGG + Intergenic
1055727946 9:79251625-79251647 CATTAGGGGAAGACTGGAGATGG - Intergenic
1056257340 9:84813627-84813649 CAGCAAAGGGAGACAGCTGAGGG - Intronic
1056403535 9:86251940-86251962 CACGAGAGAGAGAGAGGAGAGGG + Intronic
1056439185 9:86603298-86603320 CATGAGAGCAAGGCAGGAGAGGG - Intergenic
1056464614 9:86841573-86841595 CAGAAGAGGGACTCAGGAGATGG + Intergenic
1056603369 9:88064309-88064331 CATCCAAGAGAGACAGGAGATGG - Intergenic
1057444337 9:95103452-95103474 CAGCAGCAGGAGGCAGGAGAAGG + Intronic
1057521663 9:95765188-95765210 CATCAGAAGGAGACAGGTAGTGG - Intergenic
1057701480 9:97366145-97366167 CGTGGGAGGCAGACAGGAGAAGG - Intronic
1058540943 9:106012006-106012028 CAAAGGAGGGAGAGAGGAGATGG - Intergenic
1058865023 9:109153974-109153996 CATTAGAGGAAGGCAGGAGGAGG + Intronic
1059026897 9:110644384-110644406 CATCAGAGGCAGACACCATAAGG + Intergenic
1059350634 9:113662454-113662476 CAGGAGAAGGAGGCAGGAGAAGG - Intergenic
1059710847 9:116866367-116866389 CAGCACAGGGACAAAGGAGAAGG + Intronic
1061231673 9:129319243-129319265 CAGCAGAGGGGGCCAGGGGAGGG - Intergenic
1061792994 9:133068329-133068351 CAGCAAAGAGAGAGAGGAGAGGG + Intronic
1061795598 9:133084113-133084135 CAGCAAAGAGAGAGAGGAGAGGG + Intronic
1061947091 9:133914605-133914627 CACCAGAGAGAGAGAGGAGGGGG + Intronic
1061995612 9:134181313-134181335 CATCAGAGAGAGCAGGGAGAGGG + Intergenic
1062191158 9:135248532-135248554 CTTCAGGGAGAGGCAGGAGACGG + Intergenic
1062319553 9:135984118-135984140 CCTCAGAGGAGGACAGGGGAGGG + Intergenic
1203528264 Un_GL000213v1:110373-110395 CATCTAGGGGTGACAGGAGATGG + Intergenic
1185775541 X:2800185-2800207 GATGAGAGGGAGACAGGAAGAGG + Intronic
1185889177 X:3809245-3809267 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
1186080124 X:5922052-5922074 AATCAGAGGGAAAAGGGAGAAGG + Intronic
1188019802 X:25144732-25144754 AATCACAGCGAGACAGGAGGAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188552369 X:31378051-31378073 CAGCAAAGGGAGACAGGGGTGGG - Intronic
1188644843 X:32553174-32553196 CATCAGTGGTAGACTGGATAAGG + Intronic
1188669488 X:32866099-32866121 CATCAGAGCTAGACAGCAGGAGG + Intronic
1189363885 X:40373549-40373571 AAGGAGAGGCAGACAGGAGAGGG + Intergenic
1189367202 X:40397937-40397959 AATCAGAAGCAGACAGAAGAGGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1189985395 X:46549008-46549030 CAGGAGTGGGAGACAGGAAATGG - Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192134732 X:68586557-68586579 CTTCACAGGGTGGCAGGAGAGGG - Intergenic
1192134745 X:68586620-68586642 CTTCACAGGGTGGCAGGAGAGGG - Intergenic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1192360062 X:70433806-70433828 CATCAGGGGGAGATGGGAGGAGG + Intergenic
1192776729 X:74253210-74253232 CATGAGAGGGAGAGAGCATAAGG + Intergenic
1193816064 X:86106553-86106575 CTTCATAGGGTGGCAGGAGAGGG + Intergenic
1194131002 X:90081468-90081490 CACATGAGTGAGACAGGAGAGGG - Intergenic
1194522352 X:94934910-94934932 CTTCACAGGGTGGCAGGAGAGGG - Intergenic
1195086444 X:101418319-101418341 CTTCAGCGGGAGGCAGCAGAGGG + Intronic
1195327423 X:103769052-103769074 CATGAGAAGGAAACAAGAGAAGG + Intergenic
1195640874 X:107173502-107173524 CATCAGAGGGAGAAAAGTGGGGG + Intronic
1196055558 X:111351260-111351282 GAGAAGAGGGAGACAGGATAGGG - Intronic
1196465411 X:115967667-115967689 CCTCAGAGGGGGACAGGTCATGG - Intergenic
1196891590 X:120295986-120296008 CATCAGAGGGGGAGACAAGATGG - Intronic
1197199127 X:123733498-123733520 CGGGAGAGGGAGACGGGAGAGGG - Intergenic
1198253913 X:134908462-134908484 AATCAGAGGGAAACAGAAGGAGG - Intronic
1198762438 X:140046799-140046821 TATTAGAGGGATACAGGAGGCGG + Intergenic
1199146328 X:144372471-144372493 CAGCAGAGAGAGAGAGCAGAAGG - Intergenic
1199324950 X:146488463-146488485 CTTCACAGGGTGACAGGAGAGGG + Intergenic
1200008091 X:153101140-153101162 CAGCAAAGGAAGATAGGAGAGGG + Intergenic
1201294377 Y:12451172-12451194 GATGAGAGGGAGACAGGAAGAGG - Intergenic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1202338354 Y:23833289-23833311 CATCACAAGGTGACAGGTGAGGG - Intergenic
1202532412 Y:25836782-25836804 CATCACAAGGTGACAGGTGAGGG + Intergenic