ID: 1025776000

View in Genome Browser
Species Human (GRCh38)
Location 7:64561468-64561490
Sequence CTGTGCCTATGGAAGATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 3, 2: 7, 3: 32, 4: 211}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025775992_1025776000 29 Left 1025775992 7:64561416-64561438 CCATAAAGTTTCCAAAGGGAAAC 0: 4
1: 5
2: 8
3: 27
4: 319
Right 1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG 0: 1
1: 3
2: 7
3: 32
4: 211
1025775994_1025776000 1 Left 1025775994 7:64561444-64561466 CCCCCCAAAATTCTGATAAGATC 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG 0: 1
1: 3
2: 7
3: 32
4: 211
1025775995_1025776000 0 Left 1025775995 7:64561445-64561467 CCCCCAAAATTCTGATAAGATCT 0: 1
1: 0
2: 1
3: 18
4: 229
Right 1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG 0: 1
1: 3
2: 7
3: 32
4: 211
1025775997_1025776000 -2 Left 1025775997 7:64561447-64561469 CCCAAAATTCTGATAAGATCTCT 0: 1
1: 0
2: 1
3: 21
4: 324
Right 1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG 0: 1
1: 3
2: 7
3: 32
4: 211
1025775996_1025776000 -1 Left 1025775996 7:64561446-64561468 CCCCAAAATTCTGATAAGATCTC 0: 1
1: 0
2: 2
3: 16
4: 235
Right 1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG 0: 1
1: 3
2: 7
3: 32
4: 211
1025775991_1025776000 30 Left 1025775991 7:64561415-64561437 CCCATAAAGTTTCCAAAGGGAAA 0: 5
1: 5
2: 11
3: 44
4: 377
Right 1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG 0: 1
1: 3
2: 7
3: 32
4: 211
1025775998_1025776000 -3 Left 1025775998 7:64561448-64561470 CCAAAATTCTGATAAGATCTCTG 0: 1
1: 0
2: 3
3: 23
4: 249
Right 1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG 0: 1
1: 3
2: 7
3: 32
4: 211
1025775993_1025776000 18 Left 1025775993 7:64561427-64561449 CCAAAGGGAAACTGTGACCCCCC 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG 0: 1
1: 3
2: 7
3: 32
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025776000 Original CRISPR CTGTGCCTATGGAAGATAAA AGG Intronic
906730738 1:48078776-48078798 CTGTGCCTATGGAAATCATATGG - Intergenic
909986589 1:82168177-82168199 CTGTAGCTATGGTAGATTAAGGG - Intergenic
910403023 1:86855888-86855910 CTGTGCCTGTGCAGGGTAAAAGG + Intergenic
910515327 1:88054152-88054174 CTCTGCCTGTGGAAAAGAAAGGG - Intergenic
911441776 1:97935935-97935957 CTGTGGCAATTGAAAATAAAAGG - Intergenic
912397274 1:109355708-109355730 ATGAGCCAATGGGAGATAAAAGG + Intronic
912865978 1:113256697-113256719 CTGTCCATATGGAAGAAATATGG - Intergenic
915822069 1:159034811-159034833 CTGAGCTTATGGTATATAAAAGG - Intronic
916539866 1:165742564-165742586 ATGGGCCTATGGAAGTGAAAAGG - Intronic
916858443 1:168776357-168776379 CTGTGGGGATGGAAAATAAATGG - Intergenic
918216166 1:182393043-182393065 CAGTGCCTTTGGAAGAGGAAGGG + Intergenic
919017746 1:192062034-192062056 CTATCCCTATTGAAGATAATAGG + Intergenic
920276845 1:204812920-204812942 CTGTAGCAATAGAAGATAAAGGG - Intergenic
920878030 1:209855405-209855427 TTATTCCTATGGTAGATAAAGGG + Exonic
922348880 1:224719686-224719708 CTGAGCCTATTGAGGTTAAATGG + Intronic
924061113 1:240175401-240175423 CTGTTGCTATGGAAAATATATGG - Intronic
924778618 1:247128274-247128296 GTGTGCCTAGGGAAGACAAAAGG - Intronic
924783036 1:247170145-247170167 GTGTGCCTAGGGAAGACAAAAGG + Intronic
1066671205 10:37842115-37842137 CTGTGTCTATGGGAGGTATATGG + Intronic
1066975633 10:42365748-42365770 CTGTGCCTAGGGAAGATAAAAGG + Intergenic
1067783055 10:49223011-49223033 CTGTGCCCAGGGAAGCTATAGGG - Intergenic
1067962572 10:50872618-50872640 GTGTCCCTATGGAAGAGAATGGG - Intronic
1068081464 10:52323029-52323051 CTCTGCCTGTGCAATATAAATGG + Intergenic
1069119885 10:64556471-64556493 CAGTGCCTTTGAAACATAAAAGG - Intergenic
1071732920 10:88267091-88267113 AAATGCCTATGAAAGATAAAGGG - Intergenic
1073935050 10:108621149-108621171 CTGTGGCTATGGAAATTATATGG - Intergenic
1074920780 10:118008703-118008725 CTGGGCCTATGGCAGATTAGTGG + Exonic
1075982959 10:126756766-126756788 ATGAGACTATGGAAGATAACGGG + Intergenic
1077906255 11:6536594-6536616 CTATACCTATGGAAGATAGAAGG + Intronic
1078799235 11:14625799-14625821 AAGTGCCTATGAAAGATAAATGG - Intronic
1080789145 11:35505109-35505131 ATGTGCCTATGAATGACAAATGG - Intronic
1080907461 11:36561026-36561048 TTGTGCCTAAGGAAGGTACATGG - Intronic
1080989071 11:37508240-37508262 ATGTTCCCATGAAAGATAAAGGG - Intergenic
1081920029 11:46766461-46766483 CTGAGCATAGGGAAGAAAAATGG + Intronic
1082625085 11:55474670-55474692 CTGTGCCTATTTAAGATTCAAGG - Intergenic
1085948669 11:81303490-81303512 TTGTACATATGGAAGATGAAAGG + Intergenic
1091701026 12:2662639-2662661 CAGTGTCTATGGAATAGAAAAGG + Intronic
1092107687 12:5934288-5934310 CTGTGCAAAAGGAAGATAAATGG + Intronic
1093299862 12:17440953-17440975 CAGAGCCTATGGATGTTAAATGG - Intergenic
1093483574 12:19629158-19629180 CTTTGCCTCTGGAATATAGAAGG - Intronic
1094038056 12:26091537-26091559 CTGTGGCCATGGAAGAGAGATGG - Intergenic
1094797176 12:33988554-33988576 CTGTGACTAAGGAATAGAAAGGG - Intergenic
1095709524 12:45273728-45273750 CTGTGCCTGTGAAATAGAAATGG - Intronic
1095945579 12:47751515-47751537 CACTGCCTATGGAAGGTAGAAGG + Exonic
1096037742 12:48487710-48487732 GAGTACATATGGAAGATAAATGG - Intronic
1096373275 12:51086127-51086149 CTGTGCATACAGAAGACAAAAGG + Intergenic
1098833338 12:75390570-75390592 CTGTCCCTGAGGAAAATAAAAGG + Intronic
1101966020 12:109282483-109282505 CTGTCCCGATGAAAGATGAAAGG - Intronic
1103183484 12:118935752-118935774 CTGTGCCTATGTACGTTCAATGG - Intergenic
1103411906 12:120718223-120718245 CAGTGCCTAAGGGAGATAAAAGG + Intronic
1104452722 12:128884163-128884185 CTGTGCCCATTGATGTTAAATGG + Intronic
1105975377 13:25468500-25468522 CTGTTCCTAAGGAAGATCAAAGG + Intronic
1106772581 13:32976076-32976098 CTTTGGCTATGGAAAATAATAGG + Intergenic
1108255901 13:48611098-48611120 CTCTGCCTCTGGAAGAGGAAAGG - Intergenic
1108517039 13:51213216-51213238 CTTTGCCTCTGGAGGATAAAGGG - Intergenic
1109337366 13:61009389-61009411 CTGTGCCCAGGGAAGCTACAGGG + Intergenic
1109567124 13:64131884-64131906 CTCTGCCTATGGAAAGGAAAGGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1114245113 14:20905569-20905591 CTCTGCCTGTGGAAGAGTAAGGG + Intergenic
1114598235 14:23932696-23932718 TTGTGCAGAAGGAAGATAAAAGG - Intergenic
1114716341 14:24829704-24829726 CTGTGCCTATTGCAAATAATAGG - Intronic
1116075666 14:40107386-40107408 CTGTGACTTTAGAAGATAAATGG + Intergenic
1116295718 14:43105657-43105679 CTGCAACTATGGAAGGTAAAGGG - Intergenic
1116703877 14:48271591-48271613 CTGTGCCTATGCAAGGGAAGGGG + Intergenic
1117025633 14:51617084-51617106 CTGTCCCTACGGAAAATAAGGGG - Intronic
1117964547 14:61193204-61193226 CTTTCCCAAAGGAAGATAAATGG + Intronic
1118401504 14:65383864-65383886 TTGGGCCTAGGGAAGATAAGAGG - Intergenic
1118543602 14:66858913-66858935 CTCTGCCTGTGGAAAATAGAGGG + Intronic
1119189405 14:72670203-72670225 CCGTGCTTCTGGAAGATAGAAGG - Exonic
1119495348 14:75073573-75073595 CTGTGCCTTTGGAAGCTGAGTGG + Intronic
1120220097 14:81721989-81722011 CTCTACTTTTGGAAGATAAAGGG + Intergenic
1121275180 14:92662487-92662509 CTGTGCCTATTGAACACAAGAGG - Intronic
1202832059 14_GL000009v2_random:45843-45865 CTGTTCCTAGGGAAGCTGAAGGG - Intergenic
1125273529 15:37966947-37966969 CAGTGCCTATGGAAGAGAAAAGG + Intronic
1126386743 15:48100999-48101021 CTTTGTTTATGGAAGAAAAAAGG - Intergenic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1128411863 15:67407477-67407499 CTGTGCCTGAGGAAGATGACAGG + Intronic
1129813722 15:78533130-78533152 CTTTGCCTATGAAAGAGAAATGG + Intronic
1130850109 15:87784582-87784604 CTGTGCCCATGGAAGGAAAGTGG - Intergenic
1131173158 15:90192404-90192426 CTGTACCCATGGATGATTAATGG + Intronic
1133593102 16:7265315-7265337 CTCTGCCAAGGGAAGATACAGGG - Intronic
1138738228 16:59277882-59277904 CTATGCAAATGGAAGATAACTGG - Intergenic
1140251393 16:73297415-73297437 CTGTGTCCATGTAAGATAACAGG - Intergenic
1140698019 16:77554282-77554304 CTGTTCTTAAGGAAGATGAATGG - Intergenic
1141017807 16:80466755-80466777 CTGTGGCTAAGGGAGAGAAATGG + Intergenic
1141203670 16:81916016-81916038 CTGTATCTATGGAAAATATATGG + Intronic
1143336179 17:6173247-6173269 CTGGGCATATTGAAGAGAAAGGG - Intergenic
1144275422 17:13663635-13663657 ATGTGACTTAGGAAGATAAAGGG + Intergenic
1147638770 17:41980983-41981005 CTTGGTCTAGGGAAGATAAAGGG - Intronic
1149722057 17:58855145-58855167 CTGTGCTTCTGGAAGGGAAAGGG + Intronic
1153223568 18:2881588-2881610 CTGTGCCCATTGAAGAGGAACGG - Intronic
1154285367 18:13051019-13051041 CTGTCCCTATGGAAGACTAGAGG + Intronic
1155181065 18:23347338-23347360 CTGATCCTATAGAAGCTAAAAGG - Intronic
1156030638 18:32708319-32708341 ATGTCCCTATGGAATAAAAAGGG - Intronic
1157017705 18:43737799-43737821 CTGTGCCAATGAAAGTGAAACGG - Intergenic
1158385035 18:56980001-56980023 CTGTGGCTTTGGCAGAAAAAAGG - Intronic
1158422131 18:57304452-57304474 CTGTGCCTATGGCAAATGACTGG + Intergenic
1160165059 18:76503863-76503885 CTGCGCCTCTGGAAGAGAGAGGG + Intergenic
1162592125 19:11598851-11598873 CTGTGCCTAGGAGAGAGAAAAGG - Intronic
1162597639 19:11641407-11641429 CCGTGCCTCGGGCAGATAAAAGG - Intergenic
1162618359 19:11820111-11820133 CTGTGTCTAGGAAAGATAAAAGG - Intronic
1162627091 19:11893525-11893547 CTGTGTCTAGGAAAGATAAAAGG - Intronic
1162631391 19:11929874-11929896 CTGTGTCTAGGAAAGATAAAAGG - Intronic
1162636235 19:11969816-11969838 CTGTGTCTAGGAAAGATAAAAGG - Intronic
1162639247 19:11995130-11995152 CTGTGCCTAGGAAAAATAAAAGG - Intergenic
1162656956 19:12138496-12138518 CTGTGCCTTACGAAGATAAGAGG + Intronic
1162668534 19:12235922-12235944 CTGTGCCTAGGGAAGATAAAAGG + Intronic
1162679749 19:12331879-12331901 CTGTGCCCAGAGAAGATAAAAGG + Intronic
1162700683 19:12512659-12512681 CTGTGCCTAGGGAAGATGAAAGG + Intronic
1163893578 19:20038160-20038182 CTGTGCCTAGGAAAGATTAAAGG + Intronic
1163983649 19:20924829-20924851 CTGTGCCTAGGGAAGATAAAAGG - Intronic
1163993632 19:21022570-21022592 CTGTGCCCAGAGAAGATACAAGG - Intronic
1164005350 19:21143334-21143356 CTGTGCCTAGAGAAGATACAAGG - Intronic
1164036688 19:21462005-21462027 TTGTGCCTGTGGAAGATAAAAGG + Intronic
1164042699 19:21507503-21507525 CTATGCCTAGGGAAGATAAAAGG - Intronic
1164048858 19:21566873-21566895 CTCTGCCTAGGGAAGGTAAAAGG + Intergenic
1164054851 19:21614066-21614088 GTGTGCCTAGGGAAGATAAAAGG + Intergenic
1164055394 19:21617887-21617909 TTGTGCCTAGGGAAGATAAAAGG - Intergenic
1164070735 19:21765981-21766003 CTGTGCCTAGAGAAGGTAAAAGG + Intronic
1164229101 19:23272377-23272399 GTGTGCCTAGAAAAGATAAAAGG + Intergenic
1168217107 19:54934428-54934450 CTGGGGCTATAGAAGAGAAAGGG - Intronic
1202640625 1_KI270706v1_random:81908-81930 CTGTTCCTAGGGAAGCTGAAGGG + Intergenic
925629587 2:5876965-5876987 CAGGACCTAGGGAAGATAAAAGG + Intergenic
928491577 2:31789381-31789403 CTTTGACTATTGAAGATTAATGG - Intergenic
928764707 2:34630454-34630476 GAGTGGCTATGGAAAATAAAAGG + Intergenic
930043197 2:47145233-47145255 CTGGGCCTATTCATGATAAAGGG + Intronic
932382792 2:71300823-71300845 CTGTGCCCATAGAAAATACAGGG - Intronic
932852674 2:75201492-75201514 CTGTACTAATGGAGGATAAATGG - Intergenic
933665721 2:84963311-84963333 AATTGGCTATGGAAGATAAATGG + Intergenic
933889150 2:86750136-86750158 CAATGCCTATGAAAGATAAAGGG + Intronic
934781924 2:96975698-96975720 ATGTGTAGATGGAAGATAAAGGG - Intronic
935238077 2:101154455-101154477 CTGTGCCTATCCCAGATAAATGG - Intronic
938627907 2:133131740-133131762 ATGTGGTTGTGGAAGATAAATGG + Intronic
939350908 2:141036564-141036586 CTTTGCCTTTGGAGGAAAAAGGG - Intronic
940149745 2:150586397-150586419 CTGTGCCAATAAAAGAAAAAAGG - Intergenic
941161267 2:162037238-162037260 CTGGCCCTCTGGAAGATAAGAGG - Intronic
941296189 2:163741286-163741308 CTGTGCCTGTGGAAAGCAAAGGG - Intergenic
942798191 2:179845945-179845967 CTGTTCTTTTGAAAGATAAAGGG + Intronic
944260536 2:197671133-197671155 CTAATTCTATGGAAGATAAATGG - Intronic
945371818 2:209027939-209027961 TTGTTCCTATGGAAAATACAAGG + Intergenic
945692536 2:213056843-213056865 ATGTGCTTATGGTACATAAAAGG - Exonic
1169034449 20:2438181-2438203 CTCAGCCTAAGGAAGAGAAAGGG - Intergenic
1169949505 20:11027675-11027697 CTGAGCCAAAGCAAGATAAAGGG - Intergenic
1171355663 20:24543729-24543751 GAGTGCTTATGGAAGATAGAAGG + Intronic
1171887510 20:30668654-30668676 CTGTTCCTAGGGAAGCTGAAGGG + Intergenic
1173401882 20:42733394-42733416 CTTTGCCTTGTGAAGATAAAAGG + Intronic
1174876848 20:54235819-54235841 CTGTGCCTATTGAAGAAATGTGG + Intergenic
1176362173 21:6006732-6006754 CTGTGGCCAGGGAAGATAAAAGG - Intergenic
1178100475 21:29263217-29263239 CTGTGCCTATGCTCTATAAATGG - Intronic
1178436210 21:32560775-32560797 CTGTGCTTATGAAATATACATGG - Intergenic
1179761345 21:43531813-43531835 CTGTGGCCAGGGAAGATAAAAGG + Intronic
1182558878 22:31143490-31143512 AAATGCCTATGAAAGATAAAGGG + Intergenic
1183833124 22:40429766-40429788 CTCTGCCCATGGGAGAGAAAGGG + Exonic
952725799 3:36582861-36582883 CTCTGCCTATGGAAAAGGAAGGG + Intergenic
953613762 3:44471111-44471133 CTGTGTCTGTGGAACATTAATGG - Intronic
956966417 3:74466301-74466323 CAGGGCCTATTGAAGACAAAAGG + Intronic
957660207 3:83140431-83140453 CTGTGTTAATGGAAGATAAAGGG + Intergenic
957886628 3:86296797-86296819 CTGTGCCTTTTGAAGCTATATGG + Intergenic
960380240 3:116951332-116951354 CTGTGCATACTGAAGAGAAATGG - Intronic
963198991 3:142567646-142567668 CTGTGCCTATAGGAGATTATAGG - Intronic
963284019 3:143415496-143415518 CTCTGCCTATGTTATATAAATGG + Intronic
964158859 3:153621519-153621541 CTGTGTGTGTGGAAGAGAAAGGG + Intergenic
964961106 3:162427742-162427764 CTGTGCCTATGGAAAGGAGATGG + Intergenic
966022294 3:175229851-175229873 ATATTCATATGGAAGATAAAAGG + Intronic
1202737929 3_GL000221v1_random:25478-25500 CTGTTCCTAGGGAAGCTGAAGGG - Intergenic
970915958 4:21335207-21335229 TTGTGACTTTGGAAGATAACTGG + Intronic
970916404 4:21340872-21340894 ATGTGCATAGGGCAGATAAAAGG + Intronic
971679935 4:29684839-29684861 CTCTGCCTATGGTCTATAAATGG + Intergenic
972197734 4:36674544-36674566 ATTTGCATATGGAAGATATAGGG - Intergenic
973384139 4:49492442-49492464 CTGTTCCTAGGGAAGCTGAAGGG + Intergenic
973846087 4:54914528-54914550 GTTTGGCTATGGCAGATAAAGGG - Intergenic
974397101 4:61351649-61351671 CTGTGCCTGTGCTATATAAATGG + Intronic
976191077 4:82487566-82487588 CTCTGCCAATATAAGATAAAAGG - Intronic
976346538 4:84009561-84009583 CTCTGCATATGGGAGATAAAGGG + Intergenic
976632879 4:87257314-87257336 CATTGCCTATGGAACATCAATGG + Intergenic
979106435 4:116694898-116694920 ATGTGCAGATGGAAAATAAATGG - Intergenic
979823508 4:125203725-125203747 CTGTGGCTAGGGTAGATAATTGG + Intergenic
981405516 4:144363055-144363077 CTGTGCCTATGGAAGATGTGGGG + Intergenic
981792516 4:148554828-148554850 CTGAGCTTTTGAAAGATAAAAGG + Intergenic
984318746 4:178163365-178163387 CAATGCCTATGGTAGAAAAATGG + Intergenic
984773158 4:183455820-183455842 CTGTGCCTCAGAAAGAAAAATGG + Intergenic
1202767994 4_GL000008v2_random:167767-167789 CTGTTCCTAGGGAAGCTGAAGGG + Intergenic
986921674 5:12691454-12691476 TATTGCCTAAGGAAGATAAAAGG + Intergenic
987739826 5:21893049-21893071 TTGTTACTATAGAAGATAAAGGG - Intronic
990357849 5:54987900-54987922 CTTCCACTATGGAAGATAAAGGG + Intronic
991080124 5:62589486-62589508 ATTTGGCTATGAAAGATAAATGG - Intronic
992433248 5:76730429-76730451 CAGTGCCTATATAACATAAAAGG - Intronic
993982020 5:94553996-94554018 GTGTGCCTAGGGAAGGGAAATGG - Intronic
995281865 5:110344846-110344868 CTGAGCCTATAGAAGATATCAGG + Intronic
995344777 5:111099609-111099631 CTGTGCAGATAGAAGTTAAAAGG + Intronic
1002768127 6:261331-261353 CTGTGCATACGTAGGATAAAAGG - Intergenic
1004944742 6:20598744-20598766 TTCTGCCTCTGGAAGATGAAAGG + Intronic
1005863216 6:29917205-29917227 TTGTGCCTGTGGAAGATCACGGG - Intergenic
1010679166 6:78780204-78780226 CTATGCATATGGAAGGTAGATGG - Intergenic
1012961235 6:105624175-105624197 ATCTGTCTATGAAAGATAAAGGG - Intergenic
1013522603 6:110946817-110946839 CAGTGACTGAGGAAGATAAAGGG - Intergenic
1013933182 6:115560201-115560223 CTCTGCCTATGCTACATAAATGG + Intergenic
1014063499 6:117100317-117100339 GTGTTCCTTTGGAGGATAAAAGG + Intergenic
1014419307 6:121221160-121221182 CTCTGCCTATGCTATATAAATGG + Intronic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1025238659 7:57253075-57253097 CTGTACCTAGGGAAGATCAAAGG + Intergenic
1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG + Intronic
1025778447 7:64578517-64578539 CTGTGGCTAGGAAAGATAAAAGG - Intergenic
1025788670 7:64667449-64667471 CTGCGCCTAGGGAAGATAAAAGG - Intronic
1027657549 7:80949521-80949543 CTGTGCCTATTGTACATAAAGGG - Intergenic
1030571110 7:111225939-111225961 CACTGCCTAAGGATGATAAAGGG - Intronic
1031109284 7:117586577-117586599 ATGTCCATATGGTAGATAAATGG + Intronic
1031519305 7:122743972-122743994 CTGTGCTTATGGAAGAGGACAGG - Intronic
1036787032 8:11694749-11694771 CTGTGATCATGGAAGAAAAATGG - Intronic
1036977015 8:13424931-13424953 CAATGCATATGGAATATAAATGG + Intronic
1037278378 8:17206428-17206450 CTGCTCCTAGGGAAGATACAGGG - Intronic
1038277292 8:26132393-26132415 CTGTGACTATAGTAGATAAATGG + Intergenic
1038279513 8:26151262-26151284 TTGTACCAATGGAAAATAAAGGG - Intergenic
1041995183 8:64046835-64046857 CTGTGCTTGTGGAATTTAAAAGG + Intergenic
1043652829 8:82619933-82619955 CAGTACTTATGGAAGATAATGGG + Intergenic
1043661396 8:82746765-82746787 CTGTGCTAATGAAAGGTAAAAGG - Intergenic
1044195324 8:89369791-89369813 CTGTGCTTCTGGATAATAAAGGG + Intergenic
1045354335 8:101372004-101372026 CAGTGCCTGTGGAAAATAAGGGG + Intergenic
1045933408 8:107653282-107653304 GTGTTCCTTTGGAAGATAAGAGG + Intergenic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1051111683 9:13645707-13645729 ATGTGCCTATGCAAGCTAGATGG - Intergenic
1051328270 9:15997071-15997093 GAGTGCCTGTGAAAGATAAAGGG + Intronic
1051473556 9:17477080-17477102 CTGTGCCTATGCTCCATAAATGG + Intronic
1052237795 9:26233650-26233672 CTGTGCCTATAGAAAATGATTGG + Intergenic
1053444307 9:38140030-38140052 CTGTGACTCTTGATGATAAAAGG - Intergenic
1053884024 9:42626160-42626182 CAGTGGTAATGGAAGATAAAAGG - Intergenic
1053888644 9:42668134-42668156 CAGTGGTAATGGAAGATAAAAGG + Intergenic
1054223044 9:62433606-62433628 CAGTGGTAATGGAAGATAAAAGG - Intergenic
1054227666 9:62475581-62475603 CAGTGGTAATGGAAGATAAAAGG + Intergenic
1058321528 9:103636951-103636973 TTGTGCCTCAGGAAGAGAAAAGG - Intergenic
1058347283 9:103979322-103979344 AAATGCCTATGAAAGATAAAGGG + Intergenic
1059612078 9:115909289-115909311 CTGTATATGTGGAAGATAAAAGG + Intergenic
1060911135 9:127352041-127352063 CTGTTCCTATGTAAAATGAAGGG + Intronic
1061301574 9:129708734-129708756 CTGGCCCTTTTGAAGATAAAGGG + Intronic
1203706655 Un_KI270742v1:55922-55944 CTGTTCCTAGGGAAGCTGAAGGG - Intergenic
1185839235 X:3373264-3373286 CTTTCCCTATGGCAGATATATGG - Intergenic
1187011876 X:15287839-15287861 ATGTGCTTATGGAAGAGGAATGG + Intronic
1187346290 X:18467517-18467539 CTGTCCCTATTGAAGTTAATAGG + Intronic
1187878987 X:23828851-23828873 CTGTGACTCTGGAAGACAGAAGG - Intergenic
1188304330 X:28543924-28543946 AGATGCCTATGGAAGTTAAATGG - Intergenic
1188644433 X:32547316-32547338 ATGTGCCCATGGAGGGTAAAGGG + Intronic
1188799187 X:34505978-34506000 CTGTGACTATAGAGGAGAAAAGG - Intergenic
1189514684 X:41701127-41701149 CTGTGCCTATTTAAAATAAAAGG + Intronic
1192804767 X:74498926-74498948 CTGTGCCTATGGAATACAGTGGG + Intronic
1192945149 X:75958183-75958205 CTGTACATATGGAAAAAAAATGG - Intergenic
1197068632 X:122266612-122266634 CTGTGCCTTTGGAAAAAAGAAGG - Intergenic
1198573124 X:137979570-137979592 CTGTGTCTGTTAAAGATAAAAGG + Intergenic
1198999627 X:142619313-142619335 CTGTGCTTATGCACTATAAAAGG - Intergenic
1199084424 X:143612279-143612301 CTCTTCCCATGGAAGTTAAAGGG - Intergenic
1199219283 X:145298267-145298289 CAGTGCATATGGAAATTAAAAGG + Intergenic
1199433869 X:147790792-147790814 CTGAACCTATGGAAGGTAATGGG + Intergenic
1199530518 X:148842169-148842191 CTGTGTGGATGGAAGAGAAATGG - Intronic
1199781203 X:151061656-151061678 CTGGAACTATGGAAGATATATGG - Intergenic