ID: 1025781036

View in Genome Browser
Species Human (GRCh38)
Location 7:64602062-64602084
Sequence TATCGCAGGGCCCAGCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025781033_1025781036 -3 Left 1025781033 7:64602042-64602064 CCAAATGGAAGATTGCAATATAT No data
Right 1025781036 7:64602062-64602084 TATCGCAGGGCCCAGCAACCAGG No data
1025781032_1025781036 -2 Left 1025781032 7:64602041-64602063 CCCAAATGGAAGATTGCAATATA No data
Right 1025781036 7:64602062-64602084 TATCGCAGGGCCCAGCAACCAGG No data
1025781030_1025781036 18 Left 1025781030 7:64602021-64602043 CCTCTTTTTCATGCATGCTGCCC No data
Right 1025781036 7:64602062-64602084 TATCGCAGGGCCCAGCAACCAGG No data
1025781029_1025781036 19 Left 1025781029 7:64602020-64602042 CCCTCTTTTTCATGCATGCTGCC No data
Right 1025781036 7:64602062-64602084 TATCGCAGGGCCCAGCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025781036 Original CRISPR TATCGCAGGGCCCAGCAACC AGG Intergenic
No off target data available for this crispr