ID: 1025781325

View in Genome Browser
Species Human (GRCh38)
Location 7:64604384-64604406
Sequence TCATAATGTACCCTGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025781325_1025781326 2 Left 1025781325 7:64604384-64604406 CCTTCACTCAGGGTACATTATGA No data
Right 1025781326 7:64604409-64604431 TATACCTGTATCTAGCACCTAGG No data
1025781325_1025781329 28 Left 1025781325 7:64604384-64604406 CCTTCACTCAGGGTACATTATGA No data
Right 1025781329 7:64604435-64604457 TGTGACTCTCCTATTCTGCCTGG No data
1025781325_1025781330 29 Left 1025781325 7:64604384-64604406 CCTTCACTCAGGGTACATTATGA No data
Right 1025781330 7:64604436-64604458 GTGACTCTCCTATTCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025781325 Original CRISPR TCATAATGTACCCTGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr