ID: 1025784947

View in Genome Browser
Species Human (GRCh38)
Location 7:64635709-64635731
Sequence GTGTCTTCTTAGTAGAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025784947_1025784949 -9 Left 1025784947 7:64635709-64635731 CCATCACTCTACTAAGAAGACAC No data
Right 1025784949 7:64635723-64635745 AGAAGACACAGTCCACAGGATGG No data
1025784947_1025784950 -2 Left 1025784947 7:64635709-64635731 CCATCACTCTACTAAGAAGACAC No data
Right 1025784950 7:64635730-64635752 ACAGTCCACAGGATGGATTGAGG No data
1025784947_1025784952 12 Left 1025784947 7:64635709-64635731 CCATCACTCTACTAAGAAGACAC No data
Right 1025784952 7:64635744-64635766 GGATTGAGGCTCTCATTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025784947 Original CRISPR GTGTCTTCTTAGTAGAGTGA TGG (reversed) Intergenic
No off target data available for this crispr