ID: 1025789739

View in Genome Browser
Species Human (GRCh38)
Location 7:64678260-64678282
Sequence TTTAGCAGTACTGAATAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025789739 Original CRISPR TTTAGCAGTACTGAATAATG AGG Intronic
900905023 1:5551014-5551036 TTTAGCTATCATGAATAATGCGG - Intergenic
901363473 1:8725184-8725206 TTTAACATTACTGAAAGATGTGG + Intronic
901912504 1:12471628-12471650 TATAACTGTACTGAAAAATGGGG - Intronic
903315411 1:22500583-22500605 TTCAGCAGCACTGAAGTATGTGG - Intronic
903622044 1:24704879-24704901 TCTAACAATAATGAATAATGAGG - Intergenic
906043927 1:42813133-42813155 TTTGAAAGTACTGAAGAATGAGG + Intronic
911067103 1:93799958-93799980 TTTGGGACTACTGAATGATGGGG + Intronic
911567320 1:99478097-99478119 TTCATCACTATTGAATAATGAGG - Intergenic
914934602 1:151967599-151967621 TTATGCATTACTGCATAATGGGG + Intergenic
917769240 1:178258819-178258841 TTTGGCACTTATGAATAATGCGG - Intronic
918803772 1:189011324-189011346 TTTATCAATACTGAATAATGTGG + Intergenic
919267408 1:195288011-195288033 TTTAGAAGTACTGAATTTTCAGG - Intergenic
919512094 1:198477888-198477910 ATAAGCAATAATGAATAATGGGG + Intergenic
920120840 1:203656584-203656606 TTTAGGATTAATGAATAACGAGG + Intronic
921348099 1:214207718-214207740 TTTCACAATGCTGAATAATGGGG - Intergenic
921660896 1:217801248-217801270 GGTAGCAGTTATGAATAATGGGG - Intronic
1063011206 10:2023396-2023418 TCTACCATTTCTGAATAATGAGG - Intergenic
1064250837 10:13705306-13705328 TTTAGCAGTACTCACCAATAGGG + Intronic
1067276150 10:44835998-44836020 TTTAGCACAACTGAATACTGGGG + Intergenic
1067654998 10:48185072-48185094 TTTAGCTGTGCTTACTAATGGGG - Intronic
1071560220 10:86640518-86640540 TTTAGCACTCCTGGATAATGAGG + Intergenic
1080735156 11:35006747-35006769 GTTAGCAGTAGTGAAAAAAGTGG - Intronic
1081292732 11:41346722-41346744 TTGAGTAGCACTCAATAATGCGG - Intronic
1081460929 11:43272416-43272438 AATTGCAGTACTGAATCATGGGG + Intergenic
1081473217 11:43396850-43396872 TTTAACAGTCCTGAGGAATGTGG - Intronic
1082259607 11:50068366-50068388 TTAAGCAGTAATTAAGAATGAGG + Intergenic
1086048863 11:82565473-82565495 TTTCGCTGTACAGAAAAATGGGG - Intergenic
1086937346 11:92759427-92759449 TTTAACAGTACAGAATGAGGGGG + Intronic
1087109606 11:94449380-94449402 TATAGGATTAATGAATAATGAGG - Intronic
1087896664 11:103594065-103594087 TTTAGAAGTAATTAATAATGGGG - Intergenic
1088361406 11:108993940-108993962 TCTAGCTGTACTGAAAACTGTGG - Intergenic
1091476139 12:774729-774751 TTTAACAGTATTGATAAATGGGG - Intronic
1093429753 12:19071222-19071244 TTTGGCAGTAGTGAATGATGTGG - Intergenic
1094694369 12:32803054-32803076 TTTAAAAGTACTGAATAAACAGG - Intronic
1095563448 12:43592691-43592713 TTTAGCATAAGTGAAAAATGAGG - Intergenic
1096257424 12:50072070-50072092 TCTAGCAGAACTGAGTGATGTGG - Intronic
1097623170 12:61966163-61966185 TATAGCAGCACAGAATGATGAGG - Intronic
1097711465 12:62921897-62921919 CTTAGGAATTCTGAATAATGGGG - Intronic
1099425649 12:82519800-82519822 TTTAGCAGTGATGAAAAATGGGG - Intergenic
1100612533 12:96203229-96203251 AATAGCATTAATGAATAATGAGG - Intronic
1100646449 12:96536927-96536949 TTTAGCAAAACAGATTAATGAGG - Intronic
1108398418 13:50013110-50013132 TTTGGTGGTACTGAACAATGTGG + Exonic
1109338410 13:61022963-61022985 TTTAGTATTAATGAATAGTGTGG - Intergenic
1110497063 13:76180479-76180501 TTTAACAGTACTGAAACTTGTGG - Intergenic
1111758371 13:92428456-92428478 TGTAACAGTACTGAAAAATATGG - Intronic
1113237792 13:108300526-108300548 TTTTGGAGTGCTGAAAAATGAGG - Intronic
1113253264 13:108477854-108477876 TTTAGCAGTGCTACAAAATGTGG - Intergenic
1117529668 14:56647629-56647651 TCCAGCAGTACTGTTTAATGGGG + Exonic
1119962483 14:78875304-78875326 ATTAGCAGTACATAAAAATGTGG - Intronic
1126471581 15:49017691-49017713 CTTAGAAGTATTGAAAAATGAGG + Intronic
1127378731 15:58409345-58409367 TTTAGCAATACTGAGAAAAGTGG + Intronic
1128383788 15:67132735-67132757 CTTAACTGTACTGAATACTGGGG + Intronic
1131599829 15:93835944-93835966 TTGAGCAGTACTAGATAGTGAGG + Intergenic
1132007522 15:98242539-98242561 TGTAGCAGTACTGAGAGATGGGG - Intergenic
1141543283 16:84743764-84743786 CTTAGCAGGAATGAATTATGTGG + Intronic
1144063281 17:11602060-11602082 GTTGGCAGTAGTGAATGATGTGG - Intronic
1145834261 17:27942003-27942025 TTAAGCAGAACAGAATCATGAGG + Intergenic
1148920971 17:51033482-51033504 TTTAGTAATACTGAAGAATGTGG - Intronic
1149014653 17:51894069-51894091 TTTGGCAGATCTGAATACTGAGG + Intronic
1149355584 17:55835849-55835871 TTTACCAGTAATGAAAACTGAGG + Intronic
1150261174 17:63792241-63792263 TTAAGTAGTACTTAATAATTAGG + Intronic
1154080973 18:11256518-11256540 TTATGCAGTTCTGAAAAATGAGG + Intergenic
1155400498 18:25433749-25433771 CTTAGCAGTGCTGAAGACTGGGG + Intergenic
1156202035 18:34844367-34844389 TTTTACAGTACTGAAGAATGGGG - Intronic
1159247161 18:65821851-65821873 TTTCTCAATACTGAATAAAGAGG - Intronic
1163986685 19:20959702-20959724 TTTAGCAAGACTGAAGAAAGTGG + Intergenic
1164022311 19:21319382-21319404 TTTAGCAATACAGAATAATAAGG - Intronic
1202647625 1_KI270706v1_random:156925-156947 TTTTGCAGCCCTGAATAATCAGG - Intergenic
929344565 2:40865308-40865330 TTTTGCAGTGCTGAAAACTGGGG - Intergenic
930538612 2:52675988-52676010 TTAAGCAGAACTGGATCATGTGG - Intergenic
930623997 2:53676180-53676202 CTTTGCAGTACTTTATAATGAGG - Intronic
933520196 2:83362027-83362049 TTTAGCAGTTCCGCAAAATGCGG - Intergenic
936860693 2:117015340-117015362 TTTAGTAGTATTGAATTTTGAGG - Intergenic
938235571 2:129703562-129703584 TTTAGCTATTGTGAATAATGGGG + Intergenic
938611721 2:132954619-132954641 TTGAAAAGTATTGAATAATGTGG + Intronic
939866740 2:147481448-147481470 ATTACCAGTAATGAATGATGTGG - Intergenic
940488093 2:154322361-154322383 TTTAGCAGCACTCACTAAAGAGG + Intronic
940757718 2:157702558-157702580 TTAAGCAGGACTAAATAAAGTGG + Intergenic
943287270 2:186017700-186017722 TTTAGAAGTATTGAATAAATAGG + Intergenic
945456941 2:210061693-210061715 TGTACCAGTAATGAATAAAGTGG + Intronic
945863257 2:215148139-215148161 TTTTGCTTTACTGGATAATGTGG - Intergenic
948924779 2:241088492-241088514 TTTAGCAGTGCTGAGTAAGCAGG - Exonic
1169383633 20:5129226-5129248 TTGAGAAGTTCTGAATAATGGGG - Intronic
1170608158 20:17889278-17889300 TTAGACAGTACTGGATAATGGGG - Intergenic
1173912683 20:46681963-46681985 CTTAGCAGTATTGAAAGATGGGG - Intronic
1174112854 20:48208138-48208160 TTTAGCAATACTTAAAAATCAGG + Intergenic
1176604235 21:8815835-8815857 TTTTGCAGCCCTGAATAATCAGG + Intergenic
1176694006 21:9951567-9951589 TTTAGCAGTGCTTAAAAAGGAGG - Intergenic
1178472849 21:32909337-32909359 TTTAGCAGTTGTAAATATTGTGG + Intergenic
1179000283 21:37451510-37451532 TTCAGCCGTGCTGAATAATGAGG - Intronic
1180346526 22:11707442-11707464 TTTTGCAGCCCTGAATAATCAGG + Intergenic
1180354291 22:11825566-11825588 TTTTGCAGCCCTGAATAATCAGG + Intergenic
1180383964 22:12166789-12166811 TTTTGCAGCCCTGAATAATCAGG - Intergenic
949964963 3:9348081-9348103 TTTGGTGCTACTGAATAATGAGG - Intronic
950589677 3:13927790-13927812 TTATGCATTACTGAATAATTAGG - Intergenic
951070169 3:18318911-18318933 TTTAGAATTCATGAATAATGAGG + Intronic
951447145 3:22795967-22795989 TTCAGCACTACTGGAAAATGAGG + Intergenic
951489045 3:23248068-23248090 TTTTGCAATAGTGAAAAATGAGG - Intronic
952144637 3:30518453-30518475 TTTTGCAGGACTGAACAACGTGG - Intergenic
956267498 3:67413547-67413569 CTTAGTAGAACAGAATAATGTGG - Intronic
956480245 3:69665958-69665980 TTCAGCAGTAAAAAATAATGTGG - Intergenic
957489992 3:80911246-80911268 TTTATCAGATCTGAGTAATGTGG + Intergenic
960984032 3:123260299-123260321 TTTAGCAGTAATGAATAGAATGG + Intronic
961232505 3:125329851-125329873 TTTAATATTACTGAATAATATGG + Intronic
962952202 3:140229583-140229605 TTTAGCTCTCCTGAATAATCAGG - Intronic
963120912 3:141776447-141776469 TTTCTCACTACTGAACAATGTGG + Intergenic
963428863 3:145169943-145169965 TTTAGCTGTACTGCATAATGTGG - Intergenic
963842400 3:150121004-150121026 TTTACCAGTACTGAATCCTCTGG + Intergenic
965839769 3:172891324-172891346 AAGAGCAGTACTGAGTAATGGGG + Intronic
965908216 3:173737368-173737390 TTTAGGAGTAATGAAAATTGTGG - Intronic
965961927 3:174439855-174439877 TTTGGCAGTTCTGCAAAATGAGG - Intronic
967050737 3:185782166-185782188 TTTAGCAGTACTCACTACTAGGG - Intronic
970855919 4:20649331-20649353 CTTATTAGTACTCAATAATGGGG + Intergenic
970971181 4:21986048-21986070 TTGAGCAGGACAGCATAATGGGG - Intergenic
971186036 4:24377050-24377072 CTTTGCAGTACAGAATTATGGGG - Intergenic
971761245 4:30768529-30768551 TTTAGCAGGACTGAATCACAGGG - Intronic
973373883 4:49275114-49275136 TTTTGCAGCCCTGAATAATCAGG - Intergenic
973383529 4:49335125-49335147 TTTTGCAGCCCTGAATAATCAGG + Intergenic
973387134 4:49520139-49520161 TTTTGCAGCCCTGAATAATCAGG + Intergenic
973899793 4:55457005-55457027 TTTTCCAGTACTAAAGAATGTGG + Intronic
974091859 4:57319934-57319956 TTTACCAGTCCTGAAGAATAGGG + Intergenic
975907651 4:79233739-79233761 GTTAGCAGTTCTGGATCATGTGG - Intronic
976628629 4:87214538-87214560 TTTTGCAGTTTTGGATAATGAGG + Intronic
976818792 4:89181032-89181054 TTTAGCAATTATGAATAAAGCGG + Intergenic
977895876 4:102364554-102364576 TTTGGCAGTGATGAATAAAGTGG - Intronic
978331386 4:107616641-107616663 TTTAGCTTTACTGAATACTGTGG + Intronic
979221106 4:118226303-118226325 TTTAGCAAAAGGGAATAATGAGG - Intronic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
980366629 4:131811760-131811782 TTTAGCAGTGCTTAAAAAGGAGG - Intergenic
981594222 4:146401054-146401076 TTTAGCTGTTCTGAATCTTGGGG - Intronic
983336839 4:166405718-166405740 GTTAGCAGAACTGAATTTTGTGG + Intergenic
984184298 4:176523707-176523729 TTTAGCAGTGTTCAATAATGTGG - Intergenic
984194849 4:176646832-176646854 TTTTGCATTACTGAATAAATGGG + Intergenic
984512103 4:180692163-180692185 TTTAGGAGTCCTGAACATTGAGG + Intergenic
986849251 5:11791751-11791773 TTTAGCAGTAATGAATTAATAGG - Intronic
987693123 5:21294424-21294446 TTTAGCAGTAGAGAATTATTTGG + Intergenic
991747156 5:69755132-69755154 TTTAGCAGTAAAGAATTATTTGG - Intergenic
991750549 5:69800110-69800132 TTTAGCAGTAAAGAATTATTTGG + Intergenic
991798758 5:70335070-70335092 TTTAGCAGTAAAGAATTATTTGG - Intergenic
991826532 5:70630445-70630467 TTTAGCAGTAAAGAATTATTTGG - Intergenic
991829837 5:70675011-70675033 TTTAGCAGTAAAGAATTATTTGG + Intergenic
991891089 5:71334397-71334419 TTTAGCAGTAAAGAATTATTTGG - Intergenic
994981846 5:106885250-106885272 TTTATCACTGCTGAGTAATGTGG - Intergenic
995500263 5:112797021-112797043 TGTAACAGTACTGGAAAATGAGG - Intronic
995936580 5:117523048-117523070 TTGAGCACTACTAAATAGTGTGG + Intergenic
999733683 5:154496138-154496160 TTTAGCATTTTTAAATAATGAGG + Intergenic
1000393896 5:160752629-160752651 TTTTGAAGTACTGAAAAATTTGG + Intronic
1000810425 5:165854682-165854704 TTTTGAAGTACTGAGAAATGTGG - Intergenic
1001837442 5:174844033-174844055 TTTAGGACTAGTGAATAATTGGG - Intergenic
1002826378 6:777826-777848 TGTAACAGTAATCAATAATGGGG - Intergenic
1004163815 6:13237831-13237853 TGTTACAGTACTGAATACTGTGG + Intronic
1006663947 6:35675684-35675706 TTCAGCATTACTGAATGCTGTGG + Intronic
1007041681 6:38727796-38727818 TTGAGCAGTGCTGAATGAAGGGG - Intronic
1007335932 6:41154854-41154876 TTTCCCAGAACTGAAGAATGTGG - Intergenic
1008771224 6:54981082-54981104 TTCATAAGTACTGAATAATGAGG + Intergenic
1009775649 6:68202948-68202970 TTCTGCAGTACTGAATACTTTGG + Intergenic
1011342876 6:86336799-86336821 TCTAGCATTGCTGGATAATGAGG + Intergenic
1014144564 6:117982536-117982558 ATTAGCAGTGGTGAATAATGTGG + Intronic
1015146947 6:129997583-129997605 GTAAGCAATACTGAAAAATGTGG + Intergenic
1015344373 6:132138560-132138582 TTTAGCAGTAGTGGGCAATGTGG - Intergenic
1017163261 6:151385432-151385454 TTTAGAAGTGCAGAAGAATGGGG + Intronic
1017314712 6:153017204-153017226 TTTAGCAGTGCTGAAAAGTCCGG + Intronic
1018528780 6:164741638-164741660 TTTAGCAGTAGTCAGGAATGAGG - Intergenic
1020691727 7:11363586-11363608 TTTATCAATATTGAATAATTAGG + Intergenic
1020919708 7:14247283-14247305 TTTGGCTATTCTGAATAATGCGG + Intronic
1021835152 7:24664406-24664428 TTTTCCAGTTCTGAATATTGTGG - Intronic
1022617585 7:31947572-31947594 CTTAGCAGCAGTGAATGATGGGG - Intronic
1024818458 7:53298466-53298488 TTTAGCAGTAATGACCATTGTGG - Intergenic
1025789739 7:64678260-64678282 TTTAGCAGTACTGAATAATGAGG + Intronic
1028088330 7:86665921-86665943 TTTAGGACTACACAATAATGTGG + Intronic
1030514338 7:110521252-110521274 TTTAGAATTAATGAATAATTAGG + Intergenic
1030541711 7:110838447-110838469 TATGGCAGTACTGAAAGATGGGG + Intronic
1030640154 7:111995789-111995811 TTTAGCAGCACTGCGAAATGAGG - Intronic
1031412773 7:121459684-121459706 TTAAGCAGAAATGCATAATGAGG + Intergenic
1034783596 7:153904596-153904618 TTTAGGAGTAAGGAATAAGGAGG - Intronic
1036159432 8:6372881-6372903 TTTGGCAGTACTTCATATTGTGG - Intergenic
1037157990 8:15729167-15729189 TTTAACAGTACAGGATAATATGG - Intronic
1037266264 8:17064320-17064342 TTTAGAAGAACTGAGTAATGTGG + Intronic
1037285834 8:17299205-17299227 TTTAGCATTTTTAAATAATGAGG + Exonic
1039356968 8:36829782-36829804 TTTAGTACCCCTGAATAATGTGG + Intronic
1041588789 8:59551264-59551286 TCTAGCAGTACAAAATAATTTGG - Intergenic
1042248843 8:66736068-66736090 TTTAACAGTAGTTAAGAATGGGG + Intronic
1043577052 8:81669819-81669841 TCTAGCAGTACTGAAAGGTGGGG + Intronic
1044336954 8:90996590-90996612 TTTATCAGTAGTCAATCATGAGG - Intronic
1044691816 8:94887933-94887955 TTTGGAAGCAATGAATAATGAGG + Exonic
1044974361 8:97649081-97649103 TGTTGCTGTACTGAATACTGTGG - Intronic
1046249039 8:111605988-111606010 TTTAGCTATACTGCAGAATGTGG - Intergenic
1046791378 8:118325879-118325901 TCTAGCAATACTGAATAATTTGG + Intronic
1053630982 9:39937667-39937689 TTTAGCAGTGCTTAAAAAGGAGG - Intergenic
1053774786 9:41525838-41525860 TTTAGCAGTGCTTAAAAAGGAGG + Intergenic
1054212905 9:62313031-62313053 TTTAGCAGTGCTTAAAAAGGAGG + Intergenic
1056034453 9:82588835-82588857 TTTAGCAGTAATGGATAAGTAGG - Intergenic
1058697645 9:107573215-107573237 TGTTGCTGTACTGAATACTGTGG - Intergenic
1059019548 9:110560185-110560207 TGTTACAGTACTGAATACTGTGG - Intronic
1059535951 9:115080954-115080976 TTTAGCAGTACTAGATCATTTGG - Intronic
1203697584 Un_GL000214v1:113087-113109 TTTTGCAGCCCTGAATAATCAGG - Intergenic
1203551632 Un_KI270743v1:167932-167954 TTTTGCAGCCCTGAATAATCAGG + Intergenic
1188922346 X:35992515-35992537 TTTAGCAAAACTGAAAAATGAGG + Intergenic
1189136522 X:38556228-38556250 TGTAGCAGTATTGAGAAATGTGG - Intronic
1189282723 X:39830279-39830301 TTGAGCAGTACGGAATATTGAGG + Intergenic
1189584320 X:42442384-42442406 TTTAGATGAACAGAATAATGTGG + Intergenic
1189606740 X:42686060-42686082 TTTAGCAGTAGACAATAAAGAGG + Intergenic
1189678949 X:43494145-43494167 TTTAGCACTACTCAAACATGGGG + Intergenic
1192748924 X:73967862-73967884 TTTAGCATTACTTATTACTGAGG + Intergenic
1196861410 X:120032274-120032296 TATAGCAGTTCTGACTGATGTGG + Intergenic
1197242532 X:124135347-124135369 TTTTGCAATACTGAATTATCAGG + Intronic
1197891554 X:131274933-131274955 TTTAGCAGTAAGCAATAAGGGGG - Intronic
1199993208 X:153001527-153001549 TTTAGCAGTCCTGAGGAAAGGGG + Intergenic
1201313274 Y:12617049-12617071 TATAGAATTACTGAATAAAGAGG - Intergenic
1202264495 Y:23003691-23003713 TGCTGCAGTCCTGAATAATGAGG + Intronic
1202417486 Y:24637433-24637455 TGCTGCAGTCCTGAATAATGAGG + Intronic
1202453300 Y:25032653-25032675 TGCTGCAGTCCTGAATAATGAGG - Intronic