ID: 1025789976

View in Genome Browser
Species Human (GRCh38)
Location 7:64680160-64680182
Sequence CTCTCAAAGGGGAAATAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025789976_1025789985 -6 Left 1025789976 7:64680160-64680182 CCCCACTATTTCCCCTTTGAGAG 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1025789985 7:64680177-64680199 TGAGAGGTGGCTGGAGCTGAAGG 0: 1
1: 58
2: 66
3: 163
4: 881
1025789976_1025789986 -5 Left 1025789976 7:64680160-64680182 CCCCACTATTTCCCCTTTGAGAG 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1025789986 7:64680178-64680200 GAGAGGTGGCTGGAGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025789976 Original CRISPR CTCTCAAAGGGGAAATAGTG GGG (reversed) Intronic
901471143 1:9457229-9457251 CTCTGAACGGGGACATGGTGAGG + Intergenic
902050805 1:13562341-13562363 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
903396087 1:23002878-23002900 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
904984540 1:34534199-34534221 CTCGCTAAGGAGGAATAGTGAGG - Intergenic
906049454 1:42858329-42858351 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
906378664 1:45317415-45317437 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
906700676 1:47855775-47855797 CTCACAAAGTGGAAAGAGAGAGG - Intronic
907957061 1:59239677-59239699 CTGTCAAAGTGGAGATATTGTGG - Intergenic
908732447 1:67240065-67240087 GTCTCAAAGGAGAAAGGGTGGGG - Intronic
909625047 1:77705862-77705884 TTCTAAAAAGGGAAAAAGTGTGG - Intronic
910909467 1:92218197-92218219 TTCTCAAGGGGAAAATAGGGTGG - Intronic
911966821 1:104381634-104381656 CTCTCAAAGAGGAAATTGTTGGG - Intergenic
912984587 1:114414627-114414649 TACTCAAAGGGGAAATTGTAAGG - Intronic
913131539 1:115842334-115842356 CTCTCAAAGGAGCAAAAATGTGG - Exonic
916676115 1:167065671-167065693 CTTTCCAAGAGGAAATACTGTGG - Intronic
917453576 1:175167101-175167123 CTATGAAAGGGGAAACAGGGAGG + Intronic
919771101 1:201159177-201159199 CTCTCAAAGGGGCAGTAATGTGG + Intronic
922046321 1:221949373-221949395 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
922368382 1:224886884-224886906 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
922598921 1:226835047-226835069 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
922750951 1:228069848-228069870 ATATCATAGGGGAAATAGCGTGG + Intergenic
922845516 1:228681215-228681237 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
924819970 1:247479744-247479766 CCCTCCAAAGGGAAAAAGTGAGG - Intergenic
1063490412 10:6458650-6458672 CTGCCAGAGGGGAAATGGTGAGG - Intronic
1064349457 10:14563150-14563172 CACTCAAATTGGAAATACTGGGG + Intronic
1065443242 10:25773102-25773124 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1065610480 10:27466900-27466922 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1067389906 10:45854258-45854280 CTCTTAAAGTGGAAGTATTGGGG - Intergenic
1067419592 10:46134404-46134426 CCCTCAAAGGAGCCATAGTGTGG - Intergenic
1067426427 10:46215007-46215029 CCCTCAAAGGAGCCATAGTGTGG + Intergenic
1067501562 10:46809591-46809613 CTCTTAAAGTGGAAGTATTGGGG + Intergenic
1067504943 10:46841001-46841023 CCCTCAAAGGAGCCATAGTGTGG - Intergenic
1067593015 10:47530318-47530340 CTCTTAAAGTGGAAGTACTGGGG - Intronic
1067640129 10:48038421-48038443 CTCTTAAAGTGGAAGTACTGGGG - Intergenic
1067873360 10:49981787-49981809 CTCTTAAAGTGGAAGTATTGGGG + Intergenic
1068858784 10:61825139-61825161 CTCTCAAAGGGAGAATGTTGAGG + Intergenic
1070137093 10:73704462-73704484 CTCTTAAAGTGGAAGTATTGGGG - Intergenic
1070672056 10:78384863-78384885 CTCTCAAAGAGGCTATACTGAGG + Intergenic
1070909962 10:80109323-80109345 CTCTCAAATGGAAAAGAGTAAGG + Intergenic
1071187173 10:83058929-83058951 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1071716897 10:88106173-88106195 CTTTTAAAGGGAAAAGAGTGTGG - Intergenic
1073394520 10:103207004-103207026 CTCTCTAAGAGGAAATCGTTGGG - Intergenic
1077573262 11:3356858-3356880 CTCTCAGAGGGGAAGTAAGGGGG + Intronic
1079079667 11:17405456-17405478 CTCTGGAAGGGGGGATAGTGTGG + Intronic
1082262792 11:50090199-50090221 CTCCCAGAGGAGAAAGAGTGTGG - Intergenic
1084353996 11:68624670-68624692 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1086244062 11:84729979-84730001 GTCTCAAAGGCAAAATTGTGAGG - Intronic
1087468392 11:98540104-98540126 CTCCCCAAGGGGAAATATCGTGG + Intergenic
1087750870 11:102005584-102005606 CTATCAATGGGGAAACAGTGTGG + Intergenic
1089953196 11:122548377-122548399 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1092963714 12:13621141-13621163 CTCTCAAGGGGGAGAAAGTATGG + Intronic
1093024267 12:14232359-14232381 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1093780390 12:23128952-23128974 CTGTAAAAGGGTAAATGGTGAGG + Intergenic
1097592327 12:61588676-61588698 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1097806826 12:63974462-63974484 CTTTCACATGTGAAATAGTGAGG + Intronic
1098580419 12:72092980-72093002 TTCTCACAGGGGAAATGGAGAGG - Intronic
1098919847 12:76293245-76293267 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1099872684 12:88369120-88369142 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1100312601 12:93411184-93411206 CCCTCAAAGGGGGAATCCTGAGG + Exonic
1101169536 12:102075680-102075702 CAACCAAAGGGGTAATAGTGTGG + Intronic
1102137258 12:110585731-110585753 CTCTTAAAGGTGAACAAGTGTGG + Intergenic
1102604363 12:114057283-114057305 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1102804792 12:115770202-115770224 CACACAAAGTGGAAATAATGAGG - Intergenic
1103159529 12:118717005-118717027 TTCACAAAGGGGAAATTGTGAGG + Intergenic
1103522848 12:121547935-121547957 CTCTGAAAGGGGAAAGAGGCCGG - Intronic
1104871772 12:132004094-132004116 CACTAAAAGGGGAAATGATGAGG + Intronic
1105032111 12:132891132-132891154 CTCTCTAAGAGGAAATTGTTGGG - Intronic
1105628985 13:22142409-22142431 CTCTCAAAGCAAACATAGTGAGG - Intergenic
1106191866 13:27460521-27460543 CTCATAAAGGAGAAACAGTGAGG + Intergenic
1107904290 13:45047874-45047896 CACTCAATTGGGAAATACTGTGG - Intergenic
1109847965 13:68022078-68022100 TTTTCAAAGGGGAAGTACTGGGG - Intergenic
1110124935 13:71931112-71931134 CTCTCAAAGAGCTCATAGTGTGG + Intergenic
1110650583 13:77937604-77937626 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1110748532 13:79085189-79085211 CTCTGAAGGATGAAATAGTGCGG + Intergenic
1112021389 13:95374151-95374173 CTTTAAAAGGGTAAATTGTGTGG - Intergenic
1112797513 13:103072317-103072339 CACACAAAGGGGAAAGAGTGGGG - Intergenic
1114282216 14:21203762-21203784 CACTCAAAGGAAAAATACTGAGG + Intergenic
1114328351 14:21612236-21612258 CCCTCAAAGGGGGAATCCTGAGG + Intergenic
1114766739 14:25381047-25381069 CTTACAAAGGGGAAAAAATGGGG - Intergenic
1115505564 14:34090653-34090675 CCCTCAGAGGGGAAACAGGGTGG - Intronic
1118937356 14:70300088-70300110 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1122038236 14:98963986-98964008 CTGTCAAATGGGAACTAGTGTGG - Intergenic
1124424908 15:29555731-29555753 CTCTCAGAGGGGAGTTAGGGAGG - Intronic
1125152184 15:36545514-36545536 CTCTCAGAGGGGAAGTGTTGTGG + Intergenic
1125353702 15:38794052-38794074 CCCTCAAAAGGGAAGTAGTAAGG + Intergenic
1126313015 15:47338159-47338181 CTTCCAAAGGGGAAAAAGTTTGG + Intronic
1129190193 15:73932923-73932945 CTCTCAAAGGAGAAACAGGGAGG - Intronic
1131621125 15:94069274-94069296 CTCTCAAAGGGAAAACTGTCCGG - Intergenic
1133869655 16:9675387-9675409 CTCTCTAAGAGGAAATTGTTGGG + Intronic
1134790696 16:16986831-16986853 CTGACATAGGGGAAATAATGGGG - Intergenic
1135285167 16:21187131-21187153 CTCTAAAATGGGAGGTAGTGAGG - Intergenic
1135864888 16:26092097-26092119 CTCTCAAAGGGGACAGAATGGGG + Intronic
1136230523 16:28882985-28883007 CTCTCAAAGGGGAAGGAGCGAGG + Intronic
1136529898 16:30860995-30861017 CTCTCTAAGAGGAAATTGTTGGG - Intronic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1142108675 16:88319548-88319570 CTCTCAGAGGGGAAGCAGCGGGG + Intergenic
1143414448 17:6735864-6735886 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1144054282 17:11525332-11525354 CTCTTAAAGAGGATATTGTGAGG + Intronic
1145080730 17:19892362-19892384 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1147577105 17:41609025-41609047 CTCTCAAAGGGGACCCAGTTAGG + Intergenic
1149611136 17:57958296-57958318 TTCTCACAGGGGGAATAGAGTGG + Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1152098328 17:78286022-78286044 CTTTCAATGGGTGAATAGTGTGG + Intergenic
1153086590 18:1295436-1295458 CTCAGAAAGGGGAAATATTCAGG - Intergenic
1153427710 18:4985102-4985124 CTCTCCAAAGGGAAGAAGTGGGG - Intergenic
1153824981 18:8866834-8866856 CTCTTAAAGGGCATATAATGTGG - Intergenic
1154099015 18:11451271-11451293 CTTTAAATGGGGAAATAGTATGG - Intergenic
1155961889 18:32002049-32002071 CTCTCCAAGAGGAAATTGTTGGG - Intergenic
1157158578 18:45291443-45291465 ATCTCAATGGGGAAAAAGTTGGG - Intronic
1157394640 18:47331502-47331524 CCATCAAAGGGGAAAGGGTGGGG - Intergenic
1158670804 18:59472061-59472083 CTCTGAAATGGGATATAGTGAGG - Intronic
1159189355 18:65021575-65021597 CTATCAGAGGGGGAAGAGTGGGG + Intergenic
1159230527 18:65602147-65602169 ATCTCTAAGGCTAAATAGTGTGG - Intergenic
1159465583 18:68778933-68778955 CTCTTAAAAGGTAAATAGGGTGG + Intronic
1160343621 18:78111213-78111235 CTCACAAAAAGGAAATAGAGAGG + Intergenic
1161711980 19:5853891-5853913 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1162331491 19:10032611-10032633 CTCTCGAAGGGGAAATTGCTGGG + Intergenic
1163511693 19:17739404-17739426 CCCGCAAAGGGGGAAGAGTGTGG + Intergenic
1163900333 19:20094894-20094916 CTCTCTAAGAGGAAATTGTTGGG + Intronic
1166916940 19:46201890-46201912 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1167099356 19:47394490-47394512 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1167901003 19:52622195-52622217 TTCTCAAAGAGGAAATTGTTGGG - Intronic
925065027 2:922779-922801 CTTTCAAAAGGGAAAAAGTATGG + Intergenic
926024952 2:9533625-9533647 CTCAGAAAGAGAAAATAGTGTGG - Intronic
926406785 2:12561778-12561800 CTTTCAAAGGGGGAATACTGCGG - Intergenic
930347735 2:50206482-50206504 CTCTCCAAAGGGATATAATGAGG - Intronic
940726499 2:157342035-157342057 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
941650783 2:168090390-168090412 CTCTCTAAGGGGAAAGCATGAGG - Intronic
942479433 2:176368215-176368237 GTCACAAAGAGGAAATAGAGGGG + Intergenic
943173555 2:184436045-184436067 TTCTCAAAAGGAAAATAGTTTGG + Intergenic
947310447 2:228796013-228796035 ATTTCAAAGGGGAAATGGTGAGG + Intergenic
1169398177 20:5254452-5254474 CTCTCCACTGGGAAATAATGAGG + Intergenic
1170210514 20:13842461-13842483 CTCTCAAAGGGGGAAAGCTGTGG + Intergenic
1173651914 20:44671804-44671826 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1175672746 20:60920121-60920143 TTCTCAATGGGGACATGGTGGGG + Intergenic
1178826046 21:36017810-36017832 CTCTGAAAGGGGAAGAAGAGAGG - Intergenic
1179150226 21:38803574-38803596 CTTTGGAAGGGGAAATAGGGAGG + Intergenic
1181117978 22:20645753-20645775 CTCTCATAGGTCAAATGGTGAGG - Intergenic
1184255701 22:43285632-43285654 CTCTCACAGGGGACTAAGTGCGG + Intronic
949921406 3:9005906-9005928 CTTTAAAAGGGTAAATTGTGTGG + Intronic
952296765 3:32069041-32069063 CTCTCTAAGAGGAAATTGTTGGG - Intronic
952533575 3:34287508-34287530 CTCTCCCAGGAGAAATTGTGTGG + Intergenic
952895315 3:38074935-38074957 CTCTCTAAGAGGAAATTGTTGGG + Intronic
953461176 3:43082280-43082302 CTCTCAAAGGCGGCATACTGGGG - Intronic
953834525 3:46331316-46331338 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
953841224 3:46391665-46391687 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
954161863 3:48728613-48728635 CTCTCTAAGAGGAAATTGTTGGG + Intronic
956392396 3:68787393-68787415 CTCATAAAGGGGAAAGAGAGGGG + Intronic
956612204 3:71135448-71135470 CTTTCAAAGGGGAACTATTTTGG - Intronic
957155233 3:76536922-76536944 CTCTCTAAGAGGAAATTGTTGGG + Intronic
958266613 3:91445260-91445282 CATTCAAAGGGGGGATAGTGTGG - Intergenic
958755417 3:98245427-98245449 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
959915491 3:111812374-111812396 CTCTGCAAGGGGAAATGGAGAGG + Intronic
960843858 3:121988375-121988397 CTCTCATAGTGGAAGGAGTGTGG - Exonic
961712836 3:128840458-128840480 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
962524071 3:136222152-136222174 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
962868688 3:139469516-139469538 CTTTCAAAGGGGAAATGCTGAGG - Intronic
965080367 3:164024693-164024715 CTCTCAGAGGGGAAGTATGGGGG + Intergenic
965508368 3:169541059-169541081 CTCTCAAAGATGAAATAGAATGG - Intronic
967806593 3:193719630-193719652 CTCTGAAAGGGGGCATAGAGTGG + Intergenic
969701550 4:8770481-8770503 CTTTCAAAGGCGAAATTGTCTGG - Intergenic
970082708 4:12306057-12306079 CTCTCAAAGAGGAAATTCCGTGG - Intergenic
972919594 4:43921658-43921680 CTGTCACTGTGGAAATAGTGTGG + Intergenic
973130911 4:46647541-46647563 ATCTCTATGGGGAAAGAGTGTGG + Intergenic
974639964 4:64616015-64616037 CTCTTATAGGGGAAATTGTGTGG + Intergenic
975617915 4:76265758-76265780 CTCTCAGAGGGGAAAGAGAGGGG + Intronic
975693051 4:76984556-76984578 TTCTCAAACAGGAAATACTGAGG + Intronic
977041964 4:92027659-92027681 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
977426915 4:96877752-96877774 TTCTCAGAGGGGAAAGAGTCAGG + Intergenic
978787168 4:112622761-112622783 CTCTCAAAGAGGAAAAAGCATGG - Intronic
980680509 4:136154060-136154082 CCGTCAAAAGGGAAATAGTATGG - Intergenic
981040187 4:140215308-140215330 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
982724408 4:158890409-158890431 CTCACAAATGGGAAAGAGAGTGG - Intronic
985586042 5:734936-734958 CTCTCACTGGGGAGCTAGTGTGG - Intronic
985600461 5:826348-826370 CTCTCACTGGGGAGCTAGTGTGG - Intronic
989615210 5:43331874-43331896 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
989659860 5:43787926-43787948 CTCTTTAAGAGGAAATAGTTGGG - Intergenic
989720857 5:44526213-44526235 CTGTCAAAGGGGAAACAAAGGGG + Intergenic
990524629 5:56612752-56612774 CTCACAGAGGGGAGATATTGTGG - Intergenic
990565185 5:57020913-57020935 CTCTCTAAGGGGAAATTGTTGGG + Intergenic
990812188 5:59740367-59740389 TTCTAAAAGGGAAAAGAGTGTGG + Intronic
991229146 5:64310765-64310787 ATCTGGAAGGGGAAAGAGTGTGG + Intronic
992361046 5:76038351-76038373 CTCTAAAAGTGGGAATAGTATGG + Intergenic
993784668 5:92114994-92115016 CTTTCAAGGGGGAAAGTGTGAGG - Intergenic
993849654 5:92990906-92990928 CTCTCAATGGGGACAAAGGGAGG + Intergenic
994324761 5:98436023-98436045 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
994375851 5:99015235-99015257 CTCTTTAAGGGGAAATTGTTGGG + Intergenic
994779057 5:104068432-104068454 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
995747167 5:115416059-115416081 CTCACACATGTGAAATAGTGGGG + Intergenic
996432575 5:123398078-123398100 GTCTCTTAGGGGAAAAAGTGGGG + Intronic
997678963 5:135735908-135735930 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
997770736 5:136550594-136550616 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
997788880 5:136738689-136738711 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
998663972 5:144274709-144274731 CTCTCAAGGAGGAAATAGAAAGG - Intronic
1001354583 5:171007288-171007310 CTCTCTAAGAGGAAATTGTCGGG + Intronic
1003629660 6:7774966-7774988 CACTCAAAGGAGAAACAGAGAGG + Intronic
1004363088 6:14988162-14988184 CTCTCAAAAGGTAGACAGTGGGG + Intergenic
1005276965 6:24229896-24229918 CTCTCAAAGGGGAAGTGGTGGGG - Intronic
1005682458 6:28220058-28220080 ATCTCAAAGCAGAAATATTGAGG + Intergenic
1006901600 6:37506015-37506037 CTCTCCGAGGGGCAAAAGTGAGG - Intergenic
1008988601 6:57576358-57576380 CATTCAAAGGGGGGATAGTGTGG + Intronic
1012798940 6:103800924-103800946 CTTTCAAAGTTAAAATAGTGGGG + Intergenic
1013808194 6:114016585-114016607 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1014395953 6:120926654-120926676 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1014567431 6:122967221-122967243 CACTCTAGGGGGAAAAAGTGAGG - Intergenic
1015468959 6:133580561-133580583 GTCTCAAAGGAGAAATCATGAGG + Intergenic
1016793621 6:148093933-148093955 CTCTCAAAAAAGAAAAAGTGAGG + Intergenic
1016925885 6:149347336-149347358 CTCTTTAAGAGGAAGTAGTGTGG + Intronic
1018456202 6:163955086-163955108 CTCTCAAAGAGTCAGTAGTGAGG + Intergenic
1018573956 6:165238447-165238469 CTCCAAAAGGGGAAAAAGTTGGG - Intergenic
1020089545 7:5331109-5331131 CTGACAAAGGGGTAGTAGTGAGG - Intronic
1020481239 7:8664232-8664254 CTCACAAAGGGGAAAAAGCTAGG - Intronic
1021897453 7:25250419-25250441 CTCTCAGCTGGGAAATAGCGTGG + Intergenic
1022451070 7:30515677-30515699 ATCTCAAAGGGCAAAGAGGGAGG - Intronic
1023960099 7:44919363-44919385 CTCTGAAAGGGGGTATGGTGGGG - Intergenic
1025184981 7:56850650-56850672 CTCCCAGAGGGGAAAGAGTGTGG - Intergenic
1025686953 7:63726314-63726336 CTCCCAGAGGGGAAAGAGTGTGG + Intergenic
1025789976 7:64680160-64680182 CTCTCAAAGGGGAAATAGTGGGG - Intronic
1027959759 7:84930192-84930214 CTCTCCCAGGGGACATAGTTTGG + Intergenic
1029364025 7:100105993-100106015 CTCTCAAAGAGGTAAGAGTGAGG + Exonic
1033625522 7:143106629-143106651 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1034449541 7:151129898-151129920 CTTTCAACAGGGAAATACTGGGG - Intronic
1037237191 8:16734137-16734159 CTCTAAAAGGGGAATTACTGGGG - Intergenic
1038478120 8:27883212-27883234 TTCTCCAAGGGGAAATGTTGGGG + Intronic
1042950058 8:74191940-74191962 CTCAGAAAGAGGAAATAATGCGG + Intergenic
1043720784 8:83545197-83545219 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1047140026 8:122127943-122127965 CTCTAAAATGATAAATAGTGTGG + Intergenic
1047140128 8:122129305-122129327 CTCTAAAATGTTAAATAGTGTGG + Intergenic
1047947846 8:129900340-129900362 ATTTCAAAGGGGACATAGTTGGG - Intronic
1048630167 8:136233874-136233896 CTCTCACAAGGGAAGTGGTGAGG - Intergenic
1050129422 9:2396163-2396185 TTCTCATGGGGGAAATGGTGAGG - Intergenic
1052382980 9:27791250-27791272 CTGTCAAATGGGTAATAGTTGGG + Intergenic
1057067998 9:92073105-92073127 CTCTCAAAGGGGAAATTGCTGGG - Intronic
1058600308 9:106661888-106661910 CAGTCATAGGGGAAATAGTCAGG + Intergenic
1060983661 9:127807790-127807812 GTTTCAATGGGGAAATAGTCTGG - Intronic
1061193954 9:129097406-129097428 CTCTTTAAGAGGAAATATTGGGG + Intronic
1062691457 9:137844179-137844201 CTCTCTAAGAGGAAATTGTTGGG - Intronic
1187571850 X:20512004-20512026 GTCTCAAAGGAGAAATAATTTGG - Intergenic
1187684733 X:21804956-21804978 CTTTCTAATGGGAAATGGTGGGG - Intergenic
1188201071 X:27293415-27293437 TTCTCTAAGAGGAAATAGTTGGG + Intergenic
1189705252 X:43753093-43753115 GTCTCAAAGTGGAAAAATTGGGG + Intergenic
1190896246 X:54621095-54621117 CTCTTAATGGGGAAATGGTAAGG - Intergenic
1191147615 X:57184710-57184732 CTTTCAAAAGGGAAATGCTGAGG + Intergenic
1192764712 X:74129083-74129105 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1192928306 X:75779207-75779229 CTTTCTAAGGGGAAAGAGTTAGG - Intergenic
1193536990 X:82728333-82728355 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1194936522 X:99956342-99956364 TTCTCAAAGGGTGAATAGTGTGG + Intergenic
1196272013 X:113723429-113723451 CTTTCTAAGGGGAAAAAATGGGG - Intergenic
1196375475 X:115028266-115028288 CTCTCAAAGGAGTTATTGTGAGG - Intergenic
1196469801 X:116012120-116012142 CTCTCAAAGAGGAAATTTTGGGG - Intergenic
1197513268 X:127396747-127396769 CTTTCAAATGGGAAACACTGAGG + Intergenic
1199135020 X:144239098-144239120 CTTTCAAAGGGGAAAAATTAAGG + Intergenic
1201937027 Y:19420390-19420412 CTCTCCAAGAGGAAATTGTTGGG - Intergenic
1202076619 Y:21043351-21043373 CTCTCTAAGAGGAAATTGTTGGG + Intergenic